Rmu_sc0001910.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001910.1
N/A
Physical Location & Seq
Forward (+)
11947 .. 13790
1844 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 444 bp
atgggttttaaagctcgctgcaaatcagtaatagggcttaatggttgccatctcaaaagttctcatggtgggcagctcttaaatgcagttgaagtggatacaaataacactacatgggtagttgcatatgcacatgttgagatgacgagcatagactcttgggaatggttcttaaagttgctgaaaaagagggatgataagaaggctgctacagctaagctgctccttcaaatgcaagagctgcaactacaaatgccagagttgctcgttctgcaaacgcaagagctgctgcttcaagctctcaagttgctccgtcaagctctaaaacaactggtgcaaaagataaagctcctatttcaagctctaaagcttttggaacaccaactagatcatcaaagaggcttagagaaagtggaagatagagttgaaaggatttcagattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

147

Amino Acids

16.92

Weight (kDa)

9.12

Isoelectric Point (pI)

21.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 133
AgsI TTSAA 5 cut(s) 92, 230, 296, 359, 428
ApeKI GCWGC 7 cut(s) 18, 73, 206, 220, 241, 286, 289
BbvI GCAGC 7 cut(s) 5, 85, 193, 207, 228, 273, 276
BccI CCATC 1 cut(s) 57
BciVI GTATCC 1 cut(s) 91
BfaI CTAG 1 cut(s) 386
BfmI CTRYAG 1 cut(s) 210
BfuI GTATCC 1 cut(s) 91
BisI GCNGC 7 cut(s) 19, 74, 207, 221, 242, 287, 290
BlpI GCTNAGC 1 cut(s) 216
BlsI GCNGC 7 cut(s) 20, 75, 208, 222, 243, 288, 291
Bpu1102I GCTNAGC 1 cut(s) 216
BpuEI CTTGAG 1 cut(s) 287
Bse1I ACTGG 1 cut(s) 336
BseGI GGATG 1 cut(s) 199
BseNI ACTGG 1 cut(s) 336
BseXI GCAGC 7 cut(s) 5, 85, 193, 207, 228, 273, 276
Bsp143I GATC 1 cut(s) 388
Bsp1720I GCTNAGC 1 cut(s) 216
BsrI ACTGG 1 cut(s) 336
BssMI GATC 1 cut(s) 388
BstAPI GCANNNNNTGC 2 cut(s) 241, 286
BstC8I GCNNGC 1 cut(s) 16
BstDEI CTNAG 2 cut(s) 216, 403
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 1 cut(s) 391
BstMBI GATC 1 cut(s) 388
BstMWI GCNNNNNNNGC 5 cut(s) 212, 241, 262, 271, 286
BstNSI RCATGY 1 cut(s) 137
BstSFI CTRYAG 1 cut(s) 210
BstV1I GCAGC 7 cut(s) 5, 85, 193, 207, 228, 273, 276
BsuI GTATCC 1 cut(s) 91
BtsCI GGATG 1 cut(s) 199
Cac8I GCNNGC 1 cut(s) 16
CviAII CATG 3 cut(s) 65, 114, 134
DdeI CTNAG 2 cut(s) 216, 403
DpnI GATC 1 cut(s) 390
DpnII GATC 1 cut(s) 388
DraI TTTAAA 1 cut(s) 10
FaeI CATG 3 cut(s) 68, 117, 137
FaiI YATR 6 cut(s) 66, 115, 127, 129, 135, 152
FatI CATG 3 cut(s) 64, 113, 133
FauNDI CATATG 1 cut(s) 127
Fnu4HI GCNGC 7 cut(s) 19, 74, 207, 221, 242, 287, 290
FokI GGATG 1 cut(s) 206
Fsp4HI GCNGC 7 cut(s) 19, 74, 207, 221, 242, 287, 290
FspBI CTAG 1 cut(s) 386
GluI GCNGC 7 cut(s) 19, 74, 207, 221, 242, 287, 290
Hin1II CATG 3 cut(s) 68, 117, 137
HindIII AAGCTT 1 cut(s) 368
HinfI GANTC 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 439
HpyAV CCTTC 2 cut(s) 196, 236
HpyCH4V TGCA 8 cut(s) 21, 86, 125, 131, 235, 244, 274, 337
HpyF10VI GCNNNNNNNGC 5 cut(s) 212, 241, 262, 271, 286
HpyF3I CTNAG 2 cut(s) 216, 403
Hsp92II CATG 3 cut(s) 68, 117, 137
Kzo9I GATC 1 cut(s) 388
LmnI GCTCC 3 cut(s) 228, 315, 354
LpnPI CCDG 2 cut(s) 270, 317
Lsp1109I GCAGC 7 cut(s) 5, 85, 193, 207, 228, 273, 276
MaeI CTAG 1 cut(s) 386
MalI GATC 1 cut(s) 390
MboI GATC 1 cut(s) 388
MboII GAAGA 1 cut(s) 428
MlyI GAGTC 1 cut(s) 149
MnlI CCTC 2 cut(s) 183, 392
MseI TTAA 4 cut(s) 9, 39, 80, 173
MwoI GCNNNNNNNGC 5 cut(s) 212, 241, 262, 271, 286
NdeI CATATG 1 cut(s) 127
NdeII GATC 1 cut(s) 388
NlaIII CATG 3 cut(s) 68, 117, 137
NspI RCATGY 1 cut(s) 137
PciI ACATGT 1 cut(s) 133
PkrI GCNGC 7 cut(s) 20, 75, 208, 222, 243, 288, 291
PleI GAGTC 1 cut(s) 149
PpsI GAGTC 1 cut(s) 149
PscI ACATGT 1 cut(s) 133
SaqAI TTAA 4 cut(s) 9, 39, 80, 173
SatI GCNGC 7 cut(s) 19, 74, 207, 221, 242, 287, 290
Sau3AI GATC 1 cut(s) 388
SchI GAGTC 1 cut(s) 149
SfcI CTRYAG 1 cut(s) 210
SmlI CTYRAG 1 cut(s) 302
SmoI CTYRAG 1 cut(s) 302
SspMI CTAG 1 cut(s) 386
Tru1I TTAA 4 cut(s) 9, 39, 80, 173
Tru9I TTAA 4 cut(s) 9, 39, 80, 173
TseI GCWGC 7 cut(s) 18, 73, 206, 220, 241, 286, 289
TspGWI ACGGA 1 cut(s) 302
XceI RCATGY 1 cut(s) 137
XspI CTAG 1 cut(s) 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.