Rmu_sc0002054.1_g000011

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002054.1
N/A
Physical Location & Seq
Reverse (-)
62878 .. 68887
6010 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1638 bp
atgattatatggtatgaattgttacatgttgttaacaatgtcagcaaagttctgcaaactgaagatatgcatattgatactgccatgaaagaattggaacgtcttctttcctatcttcaaaagtttacaaaaaccggatttgaggagtctttgattgaagctaaagagattgcaagtgagatggggattgaaccagcttgcctccttcgtgcggtcctccttatggtggtaccttgcggcgatttgaagcgtacatggcaacgaaggcagacccgactggattttcctcctccagtaacagccaatcacgaaacccgtcttgccaagttggttcaagctccaggtattaaagttgctctactaggtattcttgacattttaaacggtttcattgtggtggttttgagtttggccagcggcggtgtgccatcccctgtagcgggagctgacacatccggtcttggattgcttaatgaacttctaactgcattgaagactcttggacttgatgtcaatgatataagagaccagggcaaagttctgcaaactgaagatatgcatattgatactgccatgaaagaattggaacgtcttctttcctatcttcaaaagtttacaaaaaccggatttgaggagtctttgattgaagctaaagagattgcaagtgagatggggattgaaccagcttgcctcctttgtgcggtcctccttatggtggtaccttgcggcgatttgaagcgtacatggcaacgaaggcagacccgactggattttcctcctccagtaacagccaatcacgaaacccgtcttgttagtttggccagcggcggtgtgccatcgcctgtagcggtgcttggtggcatttctggccatgacatgagcaatttctttcacctcttatcatctactcatcgatacgagcgttttgatacatgcaaagttctgcaaactgaagatatgcatattgatactgccatgaaagaattggaacgtcttctttcctatcttcaaaagtttacaaaaaccggatttgaggagtctttgattgaagctaaagagattgcaagtgagatggggattgaaccagcttgcctccttcgtgcggtcctccttatggtggtaccttgcggcgatttgaagcgtacatggcaacgaaggcagacccgactggattttcctcctccagtaacagccaatcacgaaacccgtcttgttagtttggccagcggcggtgtgccatcccctgtagcggtgcttggtggaatttctggccatgacaggagcaatttctttcacctcttatcatctactcatcgatacgagcgttttgatacatggtatgtagcatttggacatcgtatgagcatattagggtttttagcggtaatggattcacaaggaggtagagctagggacctaggtaaacccagaggcaggggtagggccaaaggaagagataggattcctcatgtggaagaggtttaccatgaggaggagggggaggcatcacaaattgtgcagtctgctccacttattattgaggtggtggatgccactcatttggcaaggttagcaagaaagattatgaagctgggagctgctccatttcaagggagtacggatttgaggagtctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

545

Amino Acids

60.48

Weight (kDa)

6.4

Isoelectric Point (pI)

55.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 3 cut(s) 229, 718, 1120
AccB1I GGYRCC 3 cut(s) 229, 718, 1120
AcoI YGGCCR 5 cut(s) 411, 819, 868, 1221, 1270
AcsI RAATTY 1 cut(s) 1263
AcuI CTGAAG 3 cut(s) 81, 570, 972
AfaI GTAC 7 cut(s) 231, 253, 720, 742, 1122, 1144, 1618
AflIII ACRYGT 1 cut(s) 25
AhdI GACNNNNNGTC 1 cut(s) 509
AjnI CCWGG 2 cut(s) 340, 528
Alw26I GTCTC 1 cut(s) 519
AoxI GGCC 6 cut(s) 411, 819, 868, 1221, 1270, 1443
ApeKI GCWGC 1 cut(s) 1598
ApoI RAATTY 1 cut(s) 1263
Asp700I GAANNNNTTC 3 cut(s) 102, 591, 993
Asp718I GGTACC 3 cut(s) 229, 718, 1120
AspA2I CCTAGG 1 cut(s) 1417
AspS9I GGNCC 5 cut(s) 214, 703, 1105, 1414, 1443
AsuHPI GGTGA 2 cut(s) 884, 1286
AvaII GGWCC 4 cut(s) 214, 703, 1105, 1414
AvrII CCTAGG 1 cut(s) 1417
BaeI ACNNNNGTAYC 4 cut(s) 907, 940, 1309, 1342
BalI TGGCCA 5 cut(s) 413, 821, 870, 1223, 1272
BanI GGYRCC 3 cut(s) 229, 718, 1120
BbsI GAAGAC 4 cut(s) 95, 500, 584, 986
BbvI GCAGC 1 cut(s) 1585
BccI CCATC 6 cut(s) 175, 436, 664, 844, 1066, 1246
BciT130I CCWGG 2 cut(s) 342, 530
BcoDI GTCTC 1 cut(s) 519
BfaI CTAG 3 cut(s) 362, 1410, 1418
BfmI CTRYAG 3 cut(s) 435, 843, 1245
BisI GCNGC 7 cut(s) 238, 418, 727, 826, 1129, 1228, 1599
BlnI CCTAGG 1 cut(s) 1417
BlsI GCNGC 7 cut(s) 239, 419, 728, 827, 1130, 1229, 1600
Bme1390I CCNGG 2 cut(s) 342, 530
Bme18I GGWCC 4 cut(s) 214, 703, 1105, 1414
BmeRI GACNNNNNGTC 1 cut(s) 509
BmgT120I GGNCC 5 cut(s) 214, 703, 1105, 1414, 1443
BmiI GGNNCC 4 cut(s) 231, 720, 1122, 1415
BmrFI CCNGG 2 cut(s) 342, 530
BmsI GCATC 2 cut(s) 1514, 1540
BpiI GAAGAC 4 cut(s) 95, 500, 584, 986
BpmI CTGGAG 4 cut(s) 276, 324, 765, 1167
Bsa29I ATCGAT 2 cut(s) 913, 1315
BsaI GGTCTC 1 cut(s) 519
BsaJI CCNNGG 2 cut(s) 529, 1417
BsaWI WCCGGW 4 cut(s) 134, 455, 623, 1025
Bse1I ACTGG 6 cut(s) 282, 293, 771, 782, 1173, 1184
BseBI CCWGG 2 cut(s) 342, 530
BseCI ATCGAT 2 cut(s) 913, 1315
BseDI CCNNGG 2 cut(s) 529, 1417
BseGI GGATG 4 cut(s) 428, 452, 1238, 1555
BseNI ACTGG 6 cut(s) 282, 293, 771, 782, 1173, 1184
BseRI GAGGAG 8 cut(s) 158, 279, 647, 768, 1049, 1170, 1505, 1508
BseXI GCAGC 1 cut(s) 1585
BseYI CCCAGC 1 cut(s) 1591
BsgI GTGCAG 1 cut(s) 1538
BshFI GGCC 6 cut(s) 413, 821, 870, 1223, 1272, 1445
BshNI GGYRCC 3 cut(s) 229, 718, 1120
BshVI ATCGAT 2 cut(s) 913, 1315
BsiSI CCGG 4 cut(s) 135, 456, 624, 1026
BslFI GGGAC 1 cut(s) 1427
BsmAI GTCTC 1 cut(s) 519
BsmFI GGGAC 1 cut(s) 1427
BsnI GGCC 6 cut(s) 413, 821, 870, 1223, 1272, 1445
Bso31I GGTCTC 1 cut(s) 519
BspANI GGCC 6 cut(s) 413, 821, 870, 1223, 1272, 1445
BspDI ATCGAT 2 cut(s) 913, 1315
BspLI GGNNCC 4 cut(s) 231, 720, 1122, 1415
BspT107I GGYRCC 3 cut(s) 229, 718, 1120
BspTNI GGTCTC 1 cut(s) 519
BsrI ACTGG 6 cut(s) 282, 293, 771, 782, 1173, 1184
BssECI CCNNGG 2 cut(s) 529, 1417
BssT1I CCWWGG 1 cut(s) 1417
Bst2UI CCWGG 2 cut(s) 342, 530
Bst4CI ACNGT 1 cut(s) 386
Bst6I CTCTTC 2 cut(s) 1447, 1470
BstC8I GCNNGC 6 cut(s) 199, 415, 688, 823, 1090, 1225
BstF5I GGATG 4 cut(s) 428, 452, 1238, 1555
BstMAI GTCTC 1 cut(s) 519
BstMWI GCNNNNNNNGC 8 cut(s) 256, 265, 745, 754, 867, 1147, 1156, 1571
BstNI CCWGG 2 cut(s) 342, 530
BstNSI RCATGY 2 cut(s) 29, 936
BstSCI CCNGG 2 cut(s) 340, 528
BstSFI CTRYAG 3 cut(s) 435, 843, 1245
BstV1I GCAGC 1 cut(s) 1585
BstV2I GAAGAC 4 cut(s) 95, 500, 584, 986
BstXI CCANNNNNNTGG 1 cut(s) 1561
Bsu15I ATCGAT 2 cut(s) 913, 1315
BsuRI GGCC 6 cut(s) 413, 821, 870, 1223, 1272, 1445
BsuTUI ATCGAT 2 cut(s) 913, 1315
BtgZI GCGATG 1 cut(s) 822
BtsCI GGATG 4 cut(s) 428, 452, 1238, 1555
Cac8I GCNNGC 6 cut(s) 199, 415, 688, 823, 1090, 1225
Cfr13I GGNCC 5 cut(s) 214, 703, 1105, 1414, 1443
ClaI ATCGAT 2 cut(s) 913, 1315
Csp6I GTAC 7 cut(s) 230, 252, 719, 741, 1121, 1143, 1617
CviQI GTAC 7 cut(s) 230, 252, 719, 741, 1121, 1143, 1617
DraI TTTAAA 1 cut(s) 381
DriI GACNNNNNGTC 1 cut(s) 509
EaeI YGGCCR 5 cut(s) 411, 819, 868, 1221, 1270
Eam1104I CTCTTC 2 cut(s) 1447, 1470
Eam1105I GACNNNNNGTC 1 cut(s) 509
EarI CTCTTC 2 cut(s) 1447, 1470
Eco130I CCWWGG 1 cut(s) 1417
Eco31I GGTCTC 1 cut(s) 519
Eco47I GGWCC 4 cut(s) 214, 703, 1105, 1414
Eco57I CTGAAG 3 cut(s) 81, 570, 972
EcoO109I RGGNCCY 1 cut(s) 1414
EcoRII CCWGG 2 cut(s) 340, 528
EcoT14I CCWWGG 1 cut(s) 1417
EcoT22I ATGCAT 3 cut(s) 72, 561, 963
ErhI CCWWGG 1 cut(s) 1417
FaqI GGGAC 1 cut(s) 1427
FauI CCCGC 1 cut(s) 433
Fnu4HI GCNGC 7 cut(s) 238, 418, 727, 826, 1129, 1228, 1599
FokI GGATG 4 cut(s) 415, 439, 1225, 1562
Fsp4HI GCNGC 7 cut(s) 238, 418, 727, 826, 1129, 1228, 1599
FspBI CTAG 3 cut(s) 362, 1410, 1418
GluI GCNGC 7 cut(s) 238, 418, 727, 826, 1129, 1228, 1599
GsaI CCCAGC 1 cut(s) 1595
GsuI CTGGAG 4 cut(s) 276, 324, 765, 1167
HaeIII GGCC 6 cut(s) 413, 821, 870, 1223, 1272, 1445
HapII CCGG 4 cut(s) 135, 456, 624, 1026
HincII GTYRAC 1 cut(s) 34
HindII GTYRAC 1 cut(s) 34
HinfI GANTC 7 cut(s) 146, 496, 635, 1037, 1391, 1462, 1630
HpaI GTTAAC 1 cut(s) 34
HpaII CCGG 4 cut(s) 135, 456, 624, 1026
HphI GGTGA 2 cut(s) 884, 1286
Hpy166II GTNNAC 6 cut(s) 34, 126, 615, 1017, 1424, 1483
Hpy188III TCNNGA 4 cut(s) 308, 371, 797, 1199
Hpy8I GTNNAC 6 cut(s) 34, 126, 615, 1017, 1424, 1483
HpyAV CCTTC 5 cut(s) 215, 258, 747, 1106, 1149
HpyCH4III ACNGT 1 cut(s) 386
HpyCH4IV ACGT 3 cut(s) 100, 589, 991
HpyF10VI GCNNNNNNNGC 8 cut(s) 256, 265, 745, 754, 867, 1147, 1156, 1571
HpySE526I ACGT 3 cut(s) 100, 589, 991
KpnI GGTACC 3 cut(s) 233, 722, 1124
KspAI GTTAAC 1 cut(s) 34
LmnI GCTCC 6 cut(s) 343, 443, 1281, 1531, 1595, 1606
Lsp1109I GCAGC 1 cut(s) 1585
LweI GCATC 2 cut(s) 1514, 1540
MaeI CTAG 3 cut(s) 362, 1410, 1418
MaeII ACGT 3 cut(s) 100, 589, 991
MaeIII GTNAC 4 cut(s) 21, 295, 784, 1186
MlsI TGGCCA 5 cut(s) 413, 821, 870, 1223, 1272
MluCI AATT 8 cut(s) 17, 92, 581, 883, 983, 1263, 1285, 1512
MluNI TGGCCA 5 cut(s) 413, 821, 870, 1223, 1272
MlyI GAGTC 4 cut(s) 155, 490, 644, 1046
Mox20I TGGCCA 5 cut(s) 413, 821, 870, 1223, 1272
Mph1103I ATGCAT 3 cut(s) 72, 561, 963
MroXI GAANNNNTTC 3 cut(s) 102, 591, 993
MscI TGGCCA 5 cut(s) 413, 821, 870, 1223, 1272
MseI TTAA 4 cut(s) 33, 348, 380, 471
MslI CAYNNNNRTG 1 cut(s) 395
Msp20I TGGCCA 5 cut(s) 413, 821, 870, 1223, 1272
MspA1I CMGCKG 3 cut(s) 417, 825, 1227
MspI CCGG 4 cut(s) 135, 456, 624, 1026
MspR9I CCNGG 2 cut(s) 342, 530
MvaI CCWGG 2 cut(s) 342, 530
MwoI GCNNNNNNNGC 8 cut(s) 256, 265, 745, 754, 867, 1147, 1156, 1571
NlaIV GGNNCC 4 cut(s) 231, 720, 1122, 1415
NsiI ATGCAT 3 cut(s) 72, 561, 963
NspI RCATGY 2 cut(s) 29, 936
PciI ACATGT 1 cut(s) 25
PcsI WCGNNNNNNNCGW 2 cut(s) 919, 1321
PdmI GAANNNNTTC 3 cut(s) 102, 591, 993
PfeI GAWTC 2 cut(s) 1391, 1462
PkrI GCNGC 7 cut(s) 239, 419, 728, 827, 1130, 1229, 1600
PleI GAGTC 4 cut(s) 154, 490, 643, 1045
PpsI GAGTC 4 cut(s) 154, 490, 643, 1045
PpuMI RGGWCCY 1 cut(s) 1414
PscI ACATGT 1 cut(s) 25
Psp5II RGGWCCY 1 cut(s) 1414
Psp6I CCWGG 2 cut(s) 340, 528
PspFI CCCAGC 1 cut(s) 1591
PspGI CCWGG 2 cut(s) 340, 528
PspN4I GGNNCC 4 cut(s) 231, 720, 1122, 1415
PspPI GGNCC 5 cut(s) 214, 703, 1105, 1414, 1443
PspPPI RGGWCCY 1 cut(s) 1414
RsaI GTAC 7 cut(s) 231, 253, 720, 742, 1122, 1144, 1618
RsaNI GTAC 7 cut(s) 230, 252, 719, 741, 1121, 1143, 1617
RseI CAYNNNNRTG 1 cut(s) 395
SaqAI TTAA 4 cut(s) 33, 348, 380, 471
SatI GCNGC 7 cut(s) 238, 418, 727, 826, 1129, 1228, 1599
Sau96I GGNCC 5 cut(s) 214, 703, 1105, 1414, 1443
SchI GAGTC 4 cut(s) 155, 490, 644, 1046
ScrFI CCNGG 2 cut(s) 342, 530
SfaNI GCATC 2 cut(s) 1514, 1540
SfcI CTRYAG 3 cut(s) 435, 843, 1245
SinI GGWCC 4 cut(s) 214, 703, 1105, 1414
SmiMI CAYNNNNRTG 1 cut(s) 395
Sse9I AATT 8 cut(s) 17, 92, 581, 883, 983, 1263, 1285, 1512
SspMI CTAG 3 cut(s) 362, 1410, 1418
StyD4I CCNGG 2 cut(s) 340, 528
StyI CCWWGG 1 cut(s) 1417
TaaI ACNGT 1 cut(s) 386
TaiI ACGT 3 cut(s) 103, 592, 994
TaqI TCGA 2 cut(s) 913, 1315
TasI AATT 8 cut(s) 17, 92, 581, 883, 983, 1263, 1285, 1512
TauI GCSGC 6 cut(s) 240, 420, 729, 828, 1131, 1230
TfiI GAWTC 2 cut(s) 1391, 1462
Tru1I TTAA 4 cut(s) 33, 348, 380, 471
Tru9I TTAA 4 cut(s) 33, 348, 380, 471
TseI GCWGC 1 cut(s) 1598
TspDTI ATGAA 7 cut(s) 30, 101, 379, 489, 590, 992, 1601
TspGWI ACGGA 1 cut(s) 1634
VpaK11BI GGWCC 4 cut(s) 214, 703, 1105, 1414
XapI RAATTY 1 cut(s) 1263
XceI RCATGY 2 cut(s) 29, 936
XcmI CCANNNNNNNNNTGG 3 cut(s) 91, 580, 982
XmaJI CCTAGG 1 cut(s) 1417
XmnI GAANNNNTTC 3 cut(s) 102, 591, 993
XspI CTAG 3 cut(s) 362, 1410, 1418
Zsp2I ATGCAT 3 cut(s) 72, 561, 963
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.