Rmu_sc0002144.1_g000010

Ripening-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002144.1
N/A
Physical Location & Seq
Reverse (-)
35199 .. 35459
261 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 261 bp
atggtggtggacagtctgaatgtgacaataaattccactcaaataacaccgcagtcgtggcattgtccaccaggtcgtccaacaaggaagaggttttcacactacattaccatacatggtaatggaaggaatgtgaaggccaaggttgttgatgagtgtgactccataatgggttgtgatcctgatcatgattaccagcctccatgccctcacaacatcgttgatgcctctccagctgtttggaagggcttgggagtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.51

Weight (kDa)

6.94

Isoelectric Point (pI)

58.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KWL1 PF24300 29 - 86 5.6e-19 Kiwellin-1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 50
AclWI GGATC 1 cut(s) 173
AcsI RAATTY 1 cut(s) 31
AjnI CCWGG 1 cut(s) 70
AluBI AGCT 1 cut(s) 236
AluI AGCT 1 cut(s) 236
AlwI GGATC 1 cut(s) 173
AoxI GGCC 1 cut(s) 138
ApoI RAATTY 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 72
BclI TGATCA 1 cut(s) 184
Bme1390I CCNGG 1 cut(s) 72
BmrFI CCNGG 1 cut(s) 72
BmsI GCATC 1 cut(s) 214
BplI GAGNNNNNCTC 2 cut(s) 146, 178
BpmI CTGGAG 1 cut(s) 216
BsaBI GATNNNNATC 1 cut(s) 183
BsaJI CCNNGG 1 cut(s) 141
Bse8I GATNNNNATC 1 cut(s) 183
BseBI CCWGG 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 141
BseJI GATNNNNATC 1 cut(s) 183
BshFI GGCC 1 cut(s) 140
BsnI GGCC 1 cut(s) 140
Bsp143I GATC 2 cut(s) 178, 184
BspACI CCGC 1 cut(s) 50
BspANI GGCC 1 cut(s) 140
BspHI TCATGA 1 cut(s) 187
BspPI GGATC 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 2 cut(s) 178, 184
BssT1I CCWWGG 1 cut(s) 141
Bst2UI CCWGG 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 14
Bst6I CTCTTC 1 cut(s) 83
BstKTI GATC 2 cut(s) 181, 187
BstMBI GATC 2 cut(s) 178, 184
BstMWI GCNNNNNNNGC 2 cut(s) 58, 233
BstNI CCWGG 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 70
BstXI CCANNNNNNTGG 1 cut(s) 240
BsuRI GGCC 1 cut(s) 140
CciI TCATGA 1 cut(s) 187
CsiI ACCWGGT 1 cut(s) 70
CviAII CATG 3 cut(s) 116, 188, 204
CviJI RGCY 4 cut(s) 140, 199, 236, 249
CviKI_1 RGCY 4 cut(s) 140, 199, 236, 249
DpnI GATC 2 cut(s) 180, 186
DpnII GATC 2 cut(s) 178, 184
Eam1104I CTCTTC 1 cut(s) 83
EarI CTCTTC 1 cut(s) 83
Eco130I CCWWGG 1 cut(s) 141
EcoRII CCWGG 1 cut(s) 70
EcoT14I CCWWGG 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 3 cut(s) 119, 191, 207
FaiI YATR 5 cut(s) 113, 117, 167, 189, 205
FatI CATG 3 cut(s) 115, 187, 203
FbaI TGATCA 1 cut(s) 184
GsuI CTGGAG 1 cut(s) 216
HaeIII GGCC 1 cut(s) 140
Hin1II CATG 3 cut(s) 119, 191, 207
HinfI GANTC 1 cut(s) 161
Hpy166II GTNNAC 2 cut(s) 10, 68
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 2 cut(s) 182, 188
Hpy8I GTNNAC 2 cut(s) 10, 68
HpyAV CCTTC 3 cut(s) 120, 130, 238
HpyCH4III ACNGT 1 cut(s) 14
HpyF10VI GCNNNNNNNGC 2 cut(s) 58, 233
Hsp92II CATG 3 cut(s) 119, 191, 207
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 2 cut(s) 178, 184
LpnPI CCDG 5 cut(s) 57, 84, 195, 209, 246
LweI GCATC 1 cut(s) 214
MabI ACCWGGT 1 cut(s) 70
MaeIII GTNAC 2 cut(s) 22, 158
MalI GATC 2 cut(s) 180, 186
MboI GATC 2 cut(s) 178, 184
MboII GAAGA 1 cut(s) 100
MluCI AATT 1 cut(s) 31
MlyI GAGTC 1 cut(s) 155
MmeI TCCRAC 1 cut(s) 104
MnlI CCTC 4 cut(s) 84, 210, 219, 238
MseI TTAA 1 cut(s) 259
MslI CAYNNNNRTG 1 cut(s) 120
MspA1I CMGCKG 1 cut(s) 236
MspR9I CCNGG 1 cut(s) 72
MvaI CCWGG 1 cut(s) 72
MwoI GCNNNNNNNGC 2 cut(s) 58, 233
NdeII GATC 2 cut(s) 178, 184
NlaIII CATG 3 cut(s) 119, 191, 207
NmuCI GTSAC 2 cut(s) 22, 158
PagI TCATGA 1 cut(s) 187
PleI GAGTC 1 cut(s) 155
PpsI GAGTC 1 cut(s) 155
Psp6I CCWGG 1 cut(s) 70
PspGI CCWGG 1 cut(s) 70
PvuII CAGCTG 1 cut(s) 236
RseI CAYNNNNRTG 1 cut(s) 120
SaqAI TTAA 1 cut(s) 259
Sau3AI GATC 2 cut(s) 178, 184
SchI GAGTC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 72
SetI ASST 4 cut(s) 76, 95, 147, 238
SexAI ACCWGGT 1 cut(s) 70
SfaNI GCATC 1 cut(s) 214
SmiMI CAYNNNNRTG 1 cut(s) 120
Sse9I AATT 1 cut(s) 31
SsiI CCGC 1 cut(s) 50
StyD4I CCNGG 1 cut(s) 70
StyI CCWWGG 1 cut(s) 141
TaaI ACNGT 1 cut(s) 14
TasI AATT 1 cut(s) 31
Tru1I TTAA 1 cut(s) 259
Tru9I TTAA 1 cut(s) 259
TseFI GTSAC 2 cut(s) 22, 158
Tsp45I GTSAC 2 cut(s) 22, 158
XapI RAATTY 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.