Rmu_sc0002162.1_g000013

Prohibitin-1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002162.1
N/A
Physical Location & Seq
Reverse (-)
63297 .. 65178
1882 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 372 bp
atgaatttcaagaacgttaaggttcctaaggttccaggaggtggtgcagcttctgccttgattaaggtgggaatcattggtgggcttggcttgtatggagttgccaacagtctatacaatgtcgagggagggcatcgagccattgttttcaaccgtatcattggtgtcaaagacaagggtgaggccacaagtgccaagctgattggtgaagctattgcgaacaacccggcattcatcacactgaggaagattgaagctgctagagaaatagcacataccatggcaaattcatcaaacaaggtttacttgagttccgatgatctgctgctgaaccttcaggacttgaacttggacgtgagcaagaagaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Band_7

Protein Analysis

123

Amino Acids

12.99

Weight (kDa)

9.7

Isoelectric Point (pI)

19.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 41
AclI AACGTT 1 cut(s) 15
AcsI RAATTY 2 cut(s) 4, 286
AcuI CTGAAG 1 cut(s) 320
AfiI CCNNNNNNNGG 1 cut(s) 41
AgsI TTSAA 4 cut(s) 10, 151, 254, 346
AjiI CACGTC 1 cut(s) 355
AjnI CCWGG 1 cut(s) 34
AluBI AGCT 4 cut(s) 50, 199, 212, 257
AluI AGCT 4 cut(s) 50, 199, 212, 257
AlwNI CAGNNNCTG 1 cut(s) 53
AoxI GGCC 1 cut(s) 183
ApeKI GCWGC 3 cut(s) 47, 257, 325
ApoI RAATTY 2 cut(s) 4, 286
AsuC2I CCSGG 1 cut(s) 227
AsuHPI GGTGA 2 cut(s) 191, 218
AxyI CCTNAGG 1 cut(s) 27
BbvI GCAGC 3 cut(s) 59, 244, 312
BciT130I CCWGG 1 cut(s) 36
BcnI CCSGG 1 cut(s) 227
BfaI CTAG 1 cut(s) 261
BisI GCNGC 3 cut(s) 48, 258, 326
BlsI GCNGC 3 cut(s) 49, 259, 327
Bme1390I CCNGG 2 cut(s) 36, 227
BmgBI CACGTC 1 cut(s) 355
BmiI GGNNCC 2 cut(s) 24, 33
BmrFI CCNGG 2 cut(s) 36, 227
BmsI GCATC 1 cut(s) 142
BpuEI CTTGAG 1 cut(s) 328
BpuMI CCSGG 1 cut(s) 227
BsaJI CCNNGG 1 cut(s) 279
Bsc4I CCNNNNNNNGG 1 cut(s) 41
Bse21I CCTNAGG 1 cut(s) 27
BseBI CCWGG 1 cut(s) 36
BseDI CCNNGG 1 cut(s) 279
BseLI CCNNNNNNNGG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 233
BseXI GCAGC 3 cut(s) 59, 244, 312
BsgI GTGCAG 1 cut(s) 66
BshFI GGCC 1 cut(s) 185
BsiSI CCGG 1 cut(s) 227
BslI CCNNNNNNNGG 1 cut(s) 41
BsmI GAATGC 1 cut(s) 230
BsnI GGCC 1 cut(s) 185
Bsp143I GATC 1 cut(s) 319
Bsp19I CCATGG 1 cut(s) 279
BspANI GGCC 1 cut(s) 185
BspCNI CTCAG 1 cut(s) 234
BspLI GGNNCC 2 cut(s) 24, 33
BssECI CCNNGG 1 cut(s) 279
BssMI GATC 1 cut(s) 319
BssT1I CCWWGG 1 cut(s) 279
Bst2UI CCWGG 1 cut(s) 36
Bst4CI ACNGT 2 cut(s) 110, 155
BstAPI GCANNNNNTGC 1 cut(s) 53
BstDEI CTNAG 2 cut(s) 27, 242
BstDSI CCRYGG 1 cut(s) 279
BstKTI GATC 1 cut(s) 322
BstMBI GATC 1 cut(s) 319
BstMWI GCNNNNNNNGC 2 cut(s) 53, 191
BstNI CCWGG 1 cut(s) 36
BstSCI CCNGG 2 cut(s) 34, 225
BstV1I GCAGC 3 cut(s) 59, 244, 312
Bsu36I CCTNAGG 1 cut(s) 27
BsuRI GGCC 1 cut(s) 185
BtgI CCRYGG 1 cut(s) 279
BtrI CACGTC 1 cut(s) 355
BtsIMutI CAGTG 1 cut(s) 239
CaiI CAGNNNCTG 1 cut(s) 53
CviAII CATG 1 cut(s) 280
CviJI RGCY 8 cut(s) 50, 85, 90, 140, 185, 199, 212, 257
CviKI_1 RGCY 8 cut(s) 50, 85, 90, 140, 185, 199, 212, 257
DdeI CTNAG 2 cut(s) 27, 242
DpnI GATC 1 cut(s) 321
DpnII GATC 1 cut(s) 319
Eco130I CCWWGG 1 cut(s) 279
Eco57I CTGAAG 1 cut(s) 320
Eco81I CCTNAGG 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 34
EcoT14I CCWWGG 1 cut(s) 279
ErhI CCWWGG 1 cut(s) 279
FaeI CATG 1 cut(s) 283
FaiI YATR 4 cut(s) 96, 115, 276, 281
FalI AAGNNNNNCTT 2 cut(s) 290, 322
FatI CATG 1 cut(s) 279
Fnu4HI GCNGC 3 cut(s) 48, 258, 326
Fsp4HI GCNGC 3 cut(s) 48, 258, 326
FspBI CTAG 1 cut(s) 261
GluI GCNGC 3 cut(s) 48, 258, 326
HaeIII GGCC 1 cut(s) 185
HapII CCGG 1 cut(s) 227
Hin1II CATG 1 cut(s) 283
HinfI GANTC 1 cut(s) 72
HpaII CCGG 1 cut(s) 227
HphI GGTGA 2 cut(s) 191, 218
Hpy166II GTNNAC 1 cut(s) 304
Hpy188I TCNGA 1 cut(s) 316
Hpy188III TCNNGA 2 cut(s) 10, 338
Hpy8I GTNNAC 1 cut(s) 304
HpyAV CCTTC 1 cut(s) 344
HpyCH4III ACNGT 2 cut(s) 110, 155
HpyCH4IV ACGT 2 cut(s) 15, 354
HpyCH4V TGCA 1 cut(s) 47
HpyF10VI GCNNNNNNNGC 2 cut(s) 53, 191
HpyF3I CTNAG 2 cut(s) 27, 242
HpySE526I ACGT 2 cut(s) 15, 354
Hsp92II CATG 1 cut(s) 283
Kzo9I GATC 1 cut(s) 319
LpnPI CCDG 4 cut(s) 21, 48, 240, 323
Lsp1109I GCAGC 3 cut(s) 59, 244, 312
LweI GCATC 1 cut(s) 142
MaeI CTAG 1 cut(s) 261
MaeII ACGT 2 cut(s) 15, 354
MalI GATC 1 cut(s) 321
MboI GATC 1 cut(s) 319
MboII GAAGA 1 cut(s) 259
MluCI AATT 2 cut(s) 4, 286
MnlI CCTC 5 cut(s) 32, 118, 122, 175, 237
MseI TTAA 2 cut(s) 18, 63
MspI CCGG 1 cut(s) 227
MspR9I CCNGG 2 cut(s) 36, 227
Mva1269I GAATGC 1 cut(s) 230
MvaI CCWGG 1 cut(s) 36
MwoI GCNNNNNNNGC 2 cut(s) 53, 191
NciI CCSGG 1 cut(s) 227
NcoI CCATGG 1 cut(s) 279
NdeII GATC 1 cut(s) 319
NlaIII CATG 1 cut(s) 283
NlaIV GGNNCC 2 cut(s) 24, 33
PctI GAATGC 1 cut(s) 230
PfeI GAWTC 1 cut(s) 72
PflMI CCANNNNNTGG 1 cut(s) 41
PfoI TCCNGGA 1 cut(s) 34
PkrI GCNGC 3 cut(s) 49, 259, 327
Psp1406I AACGTT 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 34
PspGI CCWGG 1 cut(s) 34
PspN4I GGNNCC 2 cut(s) 24, 33
PstNI CAGNNNCTG 1 cut(s) 53
SaqAI TTAA 2 cut(s) 18, 63
SatI GCNGC 3 cut(s) 48, 258, 326
Sau3AI GATC 1 cut(s) 319
ScrFI CCNGG 2 cut(s) 36, 227
SfaNI GCATC 1 cut(s) 142
SmlI CTYRAG 1 cut(s) 307
SmoI CTYRAG 1 cut(s) 307
Sse9I AATT 2 cut(s) 4, 286
SspMI CTAG 1 cut(s) 261
StyD4I CCNGG 2 cut(s) 34, 225
StyI CCWWGG 1 cut(s) 279
TaaI ACNGT 2 cut(s) 110, 155
TaiI ACGT 2 cut(s) 18, 357
TaqI TCGA 2 cut(s) 123, 136
TasI AATT 2 cut(s) 4, 286
TfiI GAWTC 1 cut(s) 72
Tru1I TTAA 2 cut(s) 18, 63
Tru9I TTAA 2 cut(s) 18, 63
TscAI CASTG 1 cut(s) 246
TseI GCWGC 3 cut(s) 47, 257, 325
TspDTI ATGAA 3 cut(s) 17, 223, 279
TspRI CASTG 1 cut(s) 246
Van91I CCANNNNNTGG 1 cut(s) 41
XapI RAATTY 2 cut(s) 4, 286
XspI CTAG 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.