Rmu_sc0002239.1_g000012

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002239.1
N/A
Physical Location & Seq
Reverse (-)
51590 .. 52053
464 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 309 bp
atgagttcccttgatgccatggctgttaggctagccttatctcttgttatcgcagaggtggaggaagcggggggccaacaagttctgttcaccttgtcggacccaacagaccaggttcaaatatggagaggtgcaccatcgggttacaatcacgcccctgtggcgttggcttgctattatggggtgatgtcagtcggaaaggtccctatgatcacagcttccttctggatcactcttcagggaattcctcctggttttaggtctgaacgggtgataaccatgattggttacactcttggagacttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

102

Amino Acids

10.98

Weight (kDa)

4.75

Isoelectric Point (pI)

42.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 68
AclWI GGATC 1 cut(s) 236
AcsI RAATTY 1 cut(s) 243
AcuI CTGAAG 1 cut(s) 221
AgsI TTSAA 1 cut(s) 119
AjnI CCWGG 2 cut(s) 111, 250
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
Alw21I GWGCWC 1 cut(s) 136
Alw26I GTCTC 1 cut(s) 294
Alw44I GTGCAC 1 cut(s) 132
AlwI GGATC 1 cut(s) 236
AoxI GGCC 1 cut(s) 73
ApaLI GTGCAC 1 cut(s) 132
ApoI RAATTY 1 cut(s) 243
AspS9I GGNCC 3 cut(s) 73, 100, 202
AsuHPI GGTGA 3 cut(s) 82, 196, 283
AsuNHI GCTAGC 1 cut(s) 31
AvaII GGWCC 2 cut(s) 100, 202
BaeGI GKGCMC 1 cut(s) 136
Bbv12I GWGCWC 1 cut(s) 136
BccI CCATC 1 cut(s) 145
BciT130I CCWGG 2 cut(s) 113, 252
BclI TGATCA 1 cut(s) 210
BcoDI GTCTC 1 cut(s) 294
BfaI CTAG 1 cut(s) 32
BglI GCCNNNNNGGC 1 cut(s) 161
Bme1390I CCNGG 2 cut(s) 113, 252
Bme18I GGWCC 2 cut(s) 100, 202
BmgT120I GGNCC 3 cut(s) 73, 100, 202
BmiI GGNNCC 3 cut(s) 74, 102, 204
BmrFI CCNGG 2 cut(s) 113, 252
BmsI GCATC 1 cut(s) 4
BmtI GCTAGC 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 18
BseBI CCWGG 2 cut(s) 113, 252
BseDI CCNNGG 1 cut(s) 18
BseSI GKGCMC 1 cut(s) 136
BshFI GGCC 1 cut(s) 75
BsiHKAI GWGCWC 1 cut(s) 136
BslFI GGGAC 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 294
BsmFI GGGAC 1 cut(s) 188
BsnI GGCC 1 cut(s) 75
Bsp1286I GDGCHC 1 cut(s) 136
Bsp143I GATC 2 cut(s) 210, 228
Bsp19I CCATGG 1 cut(s) 18
BspACI CCGC 1 cut(s) 68
BspANI GGCC 1 cut(s) 75
BspLI GGNNCC 3 cut(s) 74, 102, 204
BspOI GCTAGC 1 cut(s) 35
BspPI GGATC 1 cut(s) 236
BssECI CCNNGG 1 cut(s) 18
BssMI GATC 2 cut(s) 210, 228
BssT1I CCWWGG 1 cut(s) 18
Bst2UI CCWGG 2 cut(s) 113, 252
Bst6I CTCTTC 1 cut(s) 240
BstC8I GCNNGC 2 cut(s) 33, 172
BstDSI CCRYGG 1 cut(s) 18
BstKTI GATC 2 cut(s) 213, 231
BstMAI GTCTC 1 cut(s) 294
BstMBI GATC 2 cut(s) 210, 228
BstMWI GCNNNNNNNGC 1 cut(s) 161
BstNI CCWGG 2 cut(s) 113, 252
BstSCI CCNGG 2 cut(s) 111, 250
BstSLI GKGCMC 1 cut(s) 136
BsuRI GGCC 1 cut(s) 75
BtgI CCRYGG 1 cut(s) 18
Cac8I GCNNGC 2 cut(s) 33, 172
Cfr13I GGNCC 3 cut(s) 73, 100, 202
CsiI ACCWGGT 1 cut(s) 111
CviAII CATG 2 cut(s) 19, 280
CviJI RGCY 6 cut(s) 23, 31, 35, 75, 170, 218
CviKI_1 RGCY 6 cut(s) 23, 31, 35, 75, 170, 218
DpnI GATC 2 cut(s) 212, 230
DpnII GATC 2 cut(s) 210, 228
Eam1104I CTCTTC 1 cut(s) 240
EarI CTCTTC 1 cut(s) 240
Eco130I CCWWGG 1 cut(s) 18
Eco47I GGWCC 2 cut(s) 100, 202
Eco57I CTGAAG 1 cut(s) 221
EcoO109I RGGNCCY 1 cut(s) 202
EcoRI GAATTC 1 cut(s) 243
EcoRII CCWGG 2 cut(s) 111, 250
EcoT14I CCWWGG 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 18
FaeI CATG 2 cut(s) 22, 283
FaiI YATR 5 cut(s) 20, 124, 180, 209, 281
FaqI GGGAC 1 cut(s) 188
FatI CATG 2 cut(s) 18, 279
FauI CCCGC 1 cut(s) 61
FbaI TGATCA 1 cut(s) 210
FspBI CTAG 1 cut(s) 32
HaeIII GGCC 1 cut(s) 75
Hin1II CATG 2 cut(s) 22, 283
HphI GGTGA 3 cut(s) 82, 196, 283
Hpy166II GTNNAC 2 cut(s) 90, 134
Hpy188I TCNGA 3 cut(s) 100, 197, 265
Hpy188III TCNNGA 1 cut(s) 226
Hpy8I GTNNAC 2 cut(s) 90, 134
HpyAV CCTTC 1 cut(s) 232
HpyCH4V TGCA 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 161
Hsp92II CATG 2 cut(s) 22, 283
Ksp22I TGATCA 1 cut(s) 210
Kzo9I GATC 2 cut(s) 210, 228
LpnPI CCDG 7 cut(s) 98, 125, 171, 211, 224, 237, 264
LweI GCATC 1 cut(s) 4
MabI ACCWGGT 1 cut(s) 111
MaeI CTAG 1 cut(s) 32
MaeIII GTNAC 2 cut(s) 143, 287
MalI GATC 2 cut(s) 212, 230
MboI GATC 2 cut(s) 210, 228
MboII GAAGA 1 cut(s) 227
MhlI GDGCHC 1 cut(s) 136
MluCI AATT 1 cut(s) 243
MmeI TCCRAC 2 cut(s) 78, 175
MnlI CCTC 4 cut(s) 49, 55, 122, 258
MspR9I CCNGG 2 cut(s) 113, 252
MvaI CCWGG 2 cut(s) 113, 252
MwoI GCNNNNNNNGC 1 cut(s) 161
NcoI CCATGG 1 cut(s) 18
NdeII GATC 2 cut(s) 210, 228
NheI GCTAGC 1 cut(s) 31
NlaIII CATG 2 cut(s) 22, 283
NlaIV GGNNCC 3 cut(s) 74, 102, 204
PpuMI RGGWCCY 1 cut(s) 202
Psp5II RGGWCCY 1 cut(s) 202
Psp6I CCWGG 2 cut(s) 111, 250
PspGI CCWGG 2 cut(s) 111, 250
PspN4I GGNNCC 3 cut(s) 74, 102, 204
PspPI GGNCC 3 cut(s) 73, 100, 202
PspPPI RGGWCCY 1 cut(s) 202
Sau3AI GATC 2 cut(s) 210, 228
Sau96I GGNCC 3 cut(s) 73, 100, 202
ScrFI CCNGG 2 cut(s) 113, 252
SduI GDGCHC 1 cut(s) 136
SetI ASST 7 cut(s) 60, 95, 117, 133, 204, 220, 263
SexAI ACCWGGT 1 cut(s) 111
SfaNI GCATC 1 cut(s) 4
SinI GGWCC 2 cut(s) 100, 202
Sse9I AATT 1 cut(s) 243
SsiI CCGC 1 cut(s) 68
SspMI CTAG 1 cut(s) 32
StyD4I CCNGG 2 cut(s) 111, 250
StyI CCWWGG 1 cut(s) 18
TasI AATT 1 cut(s) 243
VneI GTGCAC 1 cut(s) 132
VpaK11BI GGWCC 2 cut(s) 100, 202
XapI RAATTY 1 cut(s) 243
XspI CTAG 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.