Rmu_sc0002249.1_g000006

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002249.1
N/A
Physical Location & Seq
Forward (+)
20512 .. 20969
458 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 351 bp
atggcacctacaacagccaacgttgccgaggaaaccaaagtagcaagcatcaagacacttacgggctccgaactcaattccgtaccgtcggagtacacgtacgtcaagaacccgaacgatcaagctgatgccagcgacccagagcactcaatccccaccatcgatttcgcccaactcacctcctgctcccccgaactccggtccaaagccatcgaagagctaggcagagcttgccgggaatggggcttttttcaggtgatcaaccacggcgtacctgagaacttgatgaaatccatgatcgaggtgtgccacaagttctttgatcttcctgaggaaatgccgtaccattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

116

Amino Acids

12.96

Weight (kDa)

4.75

Isoelectric Point (pI)

61.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DIOX_N PF14226 51 - 112 3.1e-21 non-haem dioxygenase in morphine synthesis N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AclI AACGTT 1 cut(s) 21
AfaI GTAC 5 cut(s) 84, 95, 101, 273, 344
AfiI CCNNNNNNNGG 2 cut(s) 198, 241
AflIII ACRYGT 1 cut(s) 96
AluBI AGCT 3 cut(s) 125, 220, 230
AluI AGCT 3 cut(s) 125, 220, 230
Alw21I GWGCWC 1 cut(s) 147
AspS9I GGNCC 1 cut(s) 201
AsuC2I CCSGG 1 cut(s) 236
AsuHPI GGTGA 2 cut(s) 169, 268
AvaII GGWCC 1 cut(s) 201
AxyI CCTNAGG 1 cut(s) 330
BanI GGYRCC 1 cut(s) 4
BanII GRGCYC 1 cut(s) 68
Bbv12I GWGCWC 1 cut(s) 147
BccI CCATC 2 cut(s) 167, 218
BceAI ACGGC 2 cut(s) 283, 325
BclI TGATCA 1 cut(s) 258
BcnI CCSGG 1 cut(s) 236
BfaI CTAG 1 cut(s) 221
Bme1390I CCNGG 1 cut(s) 236
Bme18I GGWCC 1 cut(s) 201
BmgT120I GGNCC 1 cut(s) 201
BmiI GGNNCC 2 cut(s) 6, 67
BmrFI CCNGG 1 cut(s) 236
BmsI GCATC 2 cut(s) 57, 118
BpuMI CCSGG 1 cut(s) 236
Bsa29I ATCGAT 1 cut(s) 162
BsaAI YACGTR 1 cut(s) 99
BsaJI CCNNGG 2 cut(s) 27, 265
BsaWI WCCGGW 1 cut(s) 198
BsaXI ACNNNNNCTCC 2 cut(s) 83, 113
Bsc4I CCNNNNNNNGG 2 cut(s) 198, 241
Bse21I CCTNAGG 1 cut(s) 330
BseCI ATCGAT 1 cut(s) 162
BseDI CCNNGG 2 cut(s) 27, 265
BseLI CCNNNNNNNGG 2 cut(s) 198, 241
BseMII CTCAG 2 cut(s) 267, 321
BshNI GGYRCC 1 cut(s) 4
BshVI ATCGAT 1 cut(s) 162
BsiHKAI GWGCWC 1 cut(s) 147
BsiSI CCGG 2 cut(s) 199, 235
BsiWI CGTACG 1 cut(s) 99
BslI CCNNNNNNNGG 2 cut(s) 198, 241
Bsp1286I GDGCHC 2 cut(s) 68, 147
Bsp143I GATC 4 cut(s) 118, 258, 297, 322
BspCNI CTCAG 2 cut(s) 268, 322
BspDI ATCGAT 1 cut(s) 162
BspLI GGNNCC 2 cut(s) 6, 67
BspQI GCTCTTC 1 cut(s) 210
BspT107I GGYRCC 1 cut(s) 4
BssECI CCNNGG 2 cut(s) 27, 265
BssMI GATC 4 cut(s) 118, 258, 297, 322
Bst4CI ACNGT 1 cut(s) 87
Bst6I CTCTTC 1 cut(s) 210
BstAPI GCANNNNNTGC 1 cut(s) 231
BstBAI YACGTR 1 cut(s) 99
BstC8I GCNNGC 3 cut(s) 46, 133, 232
BstDEI CTNAG 2 cut(s) 276, 330
BstDSI CCRYGG 1 cut(s) 265
BstKTI GATC 4 cut(s) 121, 261, 300, 325
BstMBI GATC 4 cut(s) 118, 258, 297, 322
BstMWI GCNNNNNNNGC 2 cut(s) 23, 231
BstSCI CCNGG 1 cut(s) 234
Bsu15I ATCGAT 1 cut(s) 162
Bsu36I CCTNAGG 1 cut(s) 330
BsuTUI ATCGAT 1 cut(s) 162
BtgI CCRYGG 1 cut(s) 265
Cac8I GCNNGC 3 cut(s) 46, 133, 232
Cfr13I GGNCC 1 cut(s) 201
ClaI ATCGAT 1 cut(s) 162
Csp6I GTAC 5 cut(s) 83, 94, 100, 272, 343
CviAII CATG 1 cut(s) 295
CviJI RGCY 7 cut(s) 17, 66, 125, 209, 220, 230, 246
CviKI_1 RGCY 7 cut(s) 17, 66, 125, 209, 220, 230, 246
CviQI GTAC 5 cut(s) 83, 94, 100, 272, 343
DdeI CTNAG 2 cut(s) 276, 330
DpnI GATC 4 cut(s) 120, 260, 299, 324
DpnII GATC 4 cut(s) 118, 258, 297, 322
Eam1104I CTCTTC 1 cut(s) 210
EarI CTCTTC 1 cut(s) 210
Eco24I GRGCYC 1 cut(s) 68
Eco47I GGWCC 1 cut(s) 201
Eco81I CCTNAGG 1 cut(s) 330
EcoT38I GRGCYC 1 cut(s) 68
FaeI CATG 1 cut(s) 298
FaiI YATR 1 cut(s) 296
FatI CATG 1 cut(s) 294
FbaI TGATCA 1 cut(s) 258
FriOI GRGCYC 1 cut(s) 68
FspBI CTAG 1 cut(s) 221
HapII CCGG 2 cut(s) 199, 235
Hin1II CATG 1 cut(s) 298
HpaII CCGG 2 cut(s) 199, 235
HphI GGTGA 2 cut(s) 169, 268
Hpy166II GTNNAC 1 cut(s) 96
Hpy188I TCNGA 2 cut(s) 70, 91
Hpy188III TCNNGA 3 cut(s) 52, 106, 329
Hpy8I GTNNAC 1 cut(s) 96
Hpy99I CGWCG 1 cut(s) 91
HpyCH4III ACNGT 1 cut(s) 87
HpyCH4IV ACGT 3 cut(s) 21, 98, 102
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 231
HpyF3I CTNAG 2 cut(s) 276, 330
HpySE526I ACGT 3 cut(s) 21, 98, 102
Hsp92II CATG 1 cut(s) 298
Ksp22I TGATCA 1 cut(s) 258
Kzo9I GATC 4 cut(s) 118, 258, 297, 322
LguI GCTCTTC 1 cut(s) 210
LmnI GCTCC 2 cut(s) 71, 191
LpnPI CCDG 8 cut(s) 145, 153, 196, 212, 239, 248, 288, 342
LweI GCATC 2 cut(s) 57, 118
MaeI CTAG 1 cut(s) 221
MaeII ACGT 3 cut(s) 21, 98, 102
MalI GATC 4 cut(s) 120, 260, 299, 324
MboI GATC 4 cut(s) 118, 258, 297, 322
MboII GAAGA 2 cut(s) 227, 317
MhlI GDGCHC 2 cut(s) 68, 147
MluCI AATT 1 cut(s) 76
MmeI TCCRAC 1 cut(s) 69
MnlI CCTC 4 cut(s) 22, 190, 295, 325
MspI CCGG 2 cut(s) 199, 235
MspR9I CCNGG 1 cut(s) 236
MwoI GCNNNNNNNGC 2 cut(s) 23, 231
NciI CCSGG 1 cut(s) 236
NdeII GATC 4 cut(s) 118, 258, 297, 322
NlaIII CATG 1 cut(s) 298
NlaIV GGNNCC 2 cut(s) 6, 67
NmeAIII GCCGAG 1 cut(s) 52
PciSI GCTCTTC 1 cut(s) 210
PcsI WCGNNNNNNNCGW 1 cut(s) 95
Pfl23II CGTACG 1 cut(s) 99
Ppu21I YACGTR 1 cut(s) 99
Psp1406I AACGTT 1 cut(s) 21
PspLI CGTACG 1 cut(s) 99
PspN4I GGNNCC 2 cut(s) 6, 67
PspPI GGNCC 1 cut(s) 201
RsaI GTAC 5 cut(s) 84, 95, 101, 273, 344
RsaNI GTAC 5 cut(s) 83, 94, 100, 272, 343
SapI GCTCTTC 1 cut(s) 210
Sau3AI GATC 4 cut(s) 118, 258, 297, 322
Sau96I GGNCC 1 cut(s) 201
ScrFI CCNGG 1 cut(s) 236
SduI GDGCHC 2 cut(s) 68, 147
SfaNI GCATC 2 cut(s) 57, 118
SinI GGWCC 1 cut(s) 201
Sse9I AATT 1 cut(s) 76
SspMI CTAG 1 cut(s) 221
StyD4I CCNGG 1 cut(s) 234
TaaI ACNGT 1 cut(s) 87
TaiI ACGT 3 cut(s) 24, 101, 105
TaqI TCGA 3 cut(s) 162, 213, 300
TasI AATT 1 cut(s) 76
TatI WGTACW 1 cut(s) 93
TspDTI ATGAA 1 cut(s) 302
TspGWI ACGGA 1 cut(s) 70
VpaK11BI GGWCC 1 cut(s) 201
XspI CTAG 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.