Rmu_sc0002249.1_g000007

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002249.1
N/A
Physical Location & Seq
Reverse (-)
21234 .. 21716
483 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 375 bp
ctgggttttttcgcccaactcacctcctgctcccccgaactccggtccaaagccatcgaagagctaggcagagcttgccgggaatggggcttctttcaggtgatcaaccacggcgtacctgagaacttgatgaaatccatgatcgaggtgtgccacaagttctttgatcttcctgaggaggagaagaaggagttccaatcaaggaagctattggaaccaatcaagtgcggaacaagctttaacgttgcgatcgacaaagttcgtctgtggagggatttcctcaaggtcatagcacatcccgagttccactcactccacaaacccgccaattacagtgaggtttgtggagtgagtggaactcgggatgtgctatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

124

Amino Acids

14.27

Weight (kDa)

7.12

Isoelectric Point (pI)

56.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DIOX_N PF14226 11 - 108 9.6e-26 non-haem dioxygenase in morphine synthesis N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 228, 324
AclI AACGTT 1 cut(s) 243
AfaI GTAC 1 cut(s) 117
AfiI CCNNNNNNNGG 2 cut(s) 42, 85
AluBI AGCT 4 cut(s) 64, 74, 208, 237
AluI AGCT 4 cut(s) 64, 74, 208, 237
Ama87I CYCGRG 2 cut(s) 299, 360
Asp700I GAANNNNTTC 1 cut(s) 191
AspS9I GGNCC 1 cut(s) 45
AsuC2I CCSGG 1 cut(s) 80
AsuHPI GGTGA 2 cut(s) 13, 112
AvaI CYCGRG 2 cut(s) 299, 360
AvaII GGWCC 1 cut(s) 45
AxyI CCTNAGG 1 cut(s) 174
BccI CCATC 1 cut(s) 62
BceAI ACGGC 1 cut(s) 127
BclI TGATCA 1 cut(s) 102
BcnI CCSGG 1 cut(s) 80
BfaI CTAG 1 cut(s) 65
Bme1390I CCNGG 1 cut(s) 80
Bme18I GGWCC 1 cut(s) 45
BmeT110I CYCGRG 2 cut(s) 299, 360
BmgT120I GGNCC 1 cut(s) 45
BmiI GGNNCC 1 cut(s) 216
BmrFI CCNGG 1 cut(s) 80
BplI GAGNNNNNCTC 4 cut(s) 293, 325, 343, 375
BpuEI CTTGAG 1 cut(s) 266
BpuMI CCSGG 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 109
BsaWI WCCGGW 1 cut(s) 42
Bsc4I CCNNNNNNNGG 2 cut(s) 42, 85
Bse21I CCTNAGG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 109
BseGI GGATG 2 cut(s) 295, 370
BseLI CCNNNNNNNGG 2 cut(s) 42, 85
BseMII CTCAG 2 cut(s) 111, 165
BseRI GAGGAG 2 cut(s) 191, 194
Bsh1285I CGRYCG 1 cut(s) 252
BsiEI CGRYCG 1 cut(s) 252
BsiHKCI CYCGRG 2 cut(s) 299, 360
BsiSI CCGG 2 cut(s) 43, 79
BslI CCNNNNNNNGG 2 cut(s) 42, 85
BsoBI CYCGRG 2 cut(s) 299, 360
Bsp143I GATC 4 cut(s) 102, 141, 166, 249
BspACI CCGC 2 cut(s) 228, 324
BspCNI CTCAG 2 cut(s) 112, 166
BspLI GGNNCC 1 cut(s) 216
BspQI GCTCTTC 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 109
BssMI GATC 4 cut(s) 102, 141, 166, 249
Bst4CI ACNGT 1 cut(s) 335
Bst6I CTCTTC 1 cut(s) 54
BstAPI GCANNNNNTGC 1 cut(s) 75
BstC8I GCNNGC 1 cut(s) 76
BstDEI CTNAG 2 cut(s) 120, 174
BstDSI CCRYGG 1 cut(s) 109
BstF5I GGATG 2 cut(s) 295, 370
BstKTI GATC 4 cut(s) 105, 144, 169, 252
BstMBI GATC 4 cut(s) 102, 141, 166, 249
BstMCI CGRYCG 1 cut(s) 252
BstMWI GCNNNNNNNGC 2 cut(s) 75, 234
BstSCI CCNGG 1 cut(s) 78
Bsu36I CCTNAGG 1 cut(s) 174
BtgI CCRYGG 1 cut(s) 109
BtsCI GGATG 2 cut(s) 295, 370
BtsIMutI CAGTG 1 cut(s) 340
Cac8I GCNNGC 1 cut(s) 76
Cfr13I GGNCC 1 cut(s) 45
Csp6I GTAC 1 cut(s) 116
CviAII CATG 1 cut(s) 139
CviJI RGCY 6 cut(s) 53, 64, 74, 90, 208, 237
CviKI_1 RGCY 6 cut(s) 53, 64, 74, 90, 208, 237
CviQI GTAC 1 cut(s) 116
DdeI CTNAG 2 cut(s) 120, 174
DpnI GATC 4 cut(s) 104, 143, 168, 251
DpnII GATC 4 cut(s) 102, 141, 166, 249
Eam1104I CTCTTC 1 cut(s) 54
EarI CTCTTC 1 cut(s) 54
Eco47I GGWCC 1 cut(s) 45
Eco81I CCTNAGG 1 cut(s) 174
Eco88I CYCGRG 2 cut(s) 299, 360
FaeI CATG 1 cut(s) 142
FaiI YATR 3 cut(s) 140, 290, 373
FatI CATG 1 cut(s) 138
FauI CCCGC 1 cut(s) 331
FbaI TGATCA 1 cut(s) 102
FokI GGATG 1 cut(s) 282
FspBI CTAG 1 cut(s) 65
HapII CCGG 2 cut(s) 43, 79
Hin1II CATG 1 cut(s) 142
HindIII AAGCTT 1 cut(s) 235
HpaII CCGG 2 cut(s) 43, 79
HphI GGTGA 2 cut(s) 13, 112
Hpy188III TCNNGA 3 cut(s) 173, 299, 362
HpyAV CCTTC 1 cut(s) 181
HpyCH4III ACNGT 1 cut(s) 335
HpyCH4IV ACGT 1 cut(s) 243
HpyF10VI GCNNNNNNNGC 2 cut(s) 75, 234
HpyF3I CTNAG 2 cut(s) 120, 174
HpySE526I ACGT 1 cut(s) 243
Hsp92II CATG 1 cut(s) 142
Ksp22I TGATCA 1 cut(s) 102
Kzo9I GATC 4 cut(s) 102, 141, 166, 249
LguI GCTCTTC 1 cut(s) 54
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 6 cut(s) 40, 56, 83, 92, 132, 186
MaeI CTAG 1 cut(s) 65
MaeII ACGT 1 cut(s) 243
MalI GATC 4 cut(s) 104, 143, 168, 251
MboI GATC 4 cut(s) 102, 141, 166, 249
MboII GAAGA 3 cut(s) 71, 161, 196
MluCI AATT 1 cut(s) 328
MnlI CCTC 7 cut(s) 34, 139, 169, 172, 264, 290, 331
MroXI GAANNNNTTC 1 cut(s) 191
MseI TTAA 1 cut(s) 240
MspI CCGG 2 cut(s) 43, 79
MspR9I CCNGG 1 cut(s) 80
MwoI GCNNNNNNNGC 2 cut(s) 75, 234
NciI CCSGG 1 cut(s) 80
NdeII GATC 4 cut(s) 102, 141, 166, 249
NlaIII CATG 1 cut(s) 142
NlaIV GGNNCC 1 cut(s) 216
PciSI GCTCTTC 1 cut(s) 54
PcsI WCGNNNNNNNCGW 1 cut(s) 249
PdmI GAANNNNTTC 1 cut(s) 191
Ple19I CGATCG 1 cut(s) 252
Psp1406I AACGTT 1 cut(s) 243
PspN4I GGNNCC 1 cut(s) 216
PspPI GGNCC 1 cut(s) 45
PvuI CGATCG 1 cut(s) 252
RsaI GTAC 1 cut(s) 117
RsaNI GTAC 1 cut(s) 116
SapI GCTCTTC 1 cut(s) 54
SaqAI TTAA 1 cut(s) 240
Sau3AI GATC 4 cut(s) 102, 141, 166, 249
Sau96I GGNCC 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 80
SinI GGWCC 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 281
SmoI CTYRAG 1 cut(s) 281
Sse9I AATT 1 cut(s) 328
SsiI CCGC 2 cut(s) 228, 324
SspMI CTAG 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 335
TaiI ACGT 1 cut(s) 246
TaqI TCGA 3 cut(s) 57, 144, 252
TasI AATT 1 cut(s) 328
Tru1I TTAA 1 cut(s) 240
Tru9I TTAA 1 cut(s) 240
TscAI CASTG 1 cut(s) 340
TspDTI ATGAA 1 cut(s) 146
TspRI CASTG 1 cut(s) 340
VpaK11BI GGWCC 1 cut(s) 45
XmnI GAANNNNTTC 1 cut(s) 191
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.