Rmu_sc0002308.1_g000067

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002308.1
N/A
Physical Location & Seq
Reverse (-)
287788 .. 288255
468 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 468 bp
atggatgattcgctccagtacgagtataggaatgaagaagaccctagaaggttgtggatctcactcgaagaaagctttggcaacgtctgtgactccctgcttcccgacctagaagtgagatggcataatctccggttctgtgatttcaaggcagttcttgactacaacttggaagcacttcgcatcaaatccttaatggaattctatggaaaagatatcacagatgcgataatgatcgagaagactctctctaccttccctatctctgcattgatagttgctaagaactatcgtgtagatgtaactataggacggatcacaaggtttcatgagctgattggggccatgaatgttgctgaaaatcatgacaacacccttatgaagaactataattccaaacccgagggaaccaagtctatttcagagtccaattacgattgcacccctaagggacgacgccaagagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

155

Amino Acids

18.09

Weight (kDa)

5.16

Isoelectric Point (pI)

48.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 65, 323
AcsI RAATTY 1 cut(s) 200
AcyI GRCGYC 1 cut(s) 457
AfaI GTAC 1 cut(s) 20
AgsI TTSAA 1 cut(s) 148
AjuI GAANNNNNNNTTGG 2 cut(s) 60, 92
AloI GAACNNNNNNTCC 2 cut(s) 377, 409
AluBI AGCT 2 cut(s) 75, 334
AluI AGCT 2 cut(s) 75, 334
AlwI GGATC 2 cut(s) 65, 323
Ama87I CYCGRG 1 cut(s) 401
AoxI GGCC 1 cut(s) 342
ApoI RAATTY 1 cut(s) 200
Asp700I GAANNNNTTC 1 cut(s) 177
AspS9I GGNCC 1 cut(s) 342
AvaI CYCGRG 1 cut(s) 401
AxyI CCTNAGG 1 cut(s) 447
BbsI GAAGAC 2 cut(s) 45, 248
BccI CCATC 1 cut(s) 114
BfaI CTAG 2 cut(s) 45, 110
BfmI CTRYAG 1 cut(s) 306
BmeT110I CYCGRG 1 cut(s) 401
BmgT120I GGNCC 1 cut(s) 342
BmiI GGNNCC 2 cut(s) 343, 409
BmsI GCATC 2 cut(s) 192, 214
BpiI GAAGAC 2 cut(s) 45, 248
BsaBI GATNNNNATC 1 cut(s) 233
BsaHI GRCGYC 1 cut(s) 457
BsaJI CCNNGG 1 cut(s) 402
BsaWI WCCGGW 1 cut(s) 132
Bse1I ACTGG 1 cut(s) 16
Bse21I CCTNAGG 1 cut(s) 447
Bse8I GATNNNNATC 1 cut(s) 233
BseDI CCNNGG 1 cut(s) 402
BseGI GGATG 1 cut(s) 10
BseJI GATNNNNATC 1 cut(s) 233
BseNI ACTGG 1 cut(s) 16
BshFI GGCC 1 cut(s) 344
BsiHKCI CYCGRG 1 cut(s) 401
BsiSI CCGG 1 cut(s) 133
BsnI GGCC 1 cut(s) 344
BsoBI CYCGRG 1 cut(s) 401
Bsp143I GATC 3 cut(s) 57, 234, 315
BspANI GGCC 1 cut(s) 344
BspHI TCATGA 2 cut(s) 328, 364
BspLI GGNNCC 2 cut(s) 343, 409
BspPI GGATC 2 cut(s) 65, 323
BsrI ACTGG 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 402
BssMI GATC 3 cut(s) 57, 234, 315
BssNI GRCGYC 1 cut(s) 457
BstACI GRCGYC 1 cut(s) 457
BstDEI CTNAG 2 cut(s) 282, 447
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 3 cut(s) 60, 237, 318
BstMBI GATC 3 cut(s) 57, 234, 315
BstSFI CTRYAG 1 cut(s) 306
BstV2I GAAGAC 2 cut(s) 45, 248
BstX2I RGATCY 1 cut(s) 57
BstYI RGATCY 1 cut(s) 57
Bsu36I CCTNAGG 1 cut(s) 447
BsuRI GGCC 1 cut(s) 344
BtsCI GGATG 1 cut(s) 10
CciI TCATGA 2 cut(s) 328, 364
Cfr13I GGNCC 1 cut(s) 342
Csp6I GTAC 1 cut(s) 19
CviAII CATG 3 cut(s) 329, 346, 365
CviJI RGCY 3 cut(s) 75, 334, 344
CviKI_1 RGCY 3 cut(s) 75, 334, 344
CviQI GTAC 1 cut(s) 19
DdeI CTNAG 2 cut(s) 282, 447
DpnI GATC 3 cut(s) 59, 236, 317
DpnII GATC 3 cut(s) 57, 234, 315
Eco32I GATATC 1 cut(s) 217
Eco81I CCTNAGG 1 cut(s) 447
Eco88I CYCGRG 1 cut(s) 401
EcoRI GAATTC 1 cut(s) 200
EcoRV GATATC 1 cut(s) 217
FaeI CATG 3 cut(s) 332, 349, 368
FaiI YATR 9 cut(s) 27, 126, 207, 308, 330, 347, 366, 380, 390
FatI CATG 3 cut(s) 328, 345, 364
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 45, 110
HaeIII GGCC 1 cut(s) 344
HapII CCGG 1 cut(s) 133
Hin1I GRCGYC 1 cut(s) 457
Hin1II CATG 3 cut(s) 332, 349, 368
HindIII AAGCTT 1 cut(s) 73
HinfI GANTC 4 cut(s) 8, 92, 244, 425
HpaII CCGG 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 424
Hpy188III TCNNGA 5 cut(s) 104, 158, 238, 329, 365
Hpy99I CGWCG 1 cut(s) 459
HpyAV CCTTC 2 cut(s) 42, 265
HpyCH4IV ACGT 1 cut(s) 84
HpyCH4V TGCA 2 cut(s) 269, 441
HpyF3I CTNAG 2 cut(s) 282, 447
HpySE526I ACGT 1 cut(s) 84
Hsp92I GRCGYC 1 cut(s) 457
Hsp92II CATG 3 cut(s) 332, 349, 368
Kzo9I GATC 3 cut(s) 57, 234, 315
LmnI GCTCC 1 cut(s) 18
LpnPI CCDG 3 cut(s) 29, 110, 146
LweI GCATC 2 cut(s) 192, 214
MaeI CTAG 2 cut(s) 45, 110
MaeII ACGT 1 cut(s) 84
MaeIII GTNAC 2 cut(s) 89, 301
MalI GATC 3 cut(s) 59, 236, 317
MboI GATC 3 cut(s) 57, 234, 315
MboII GAAGA 5 cut(s) 47, 50, 80, 253, 394
MflI RGATCY 1 cut(s) 57
MluCI AATT 3 cut(s) 200, 391, 430
MlyI GAGTC 3 cut(s) 86, 238, 434
MnlI CCTC 1 cut(s) 397
MroXI GAANNNNTTC 1 cut(s) 177
MseI TTAA 1 cut(s) 194
MslI CAYNNNNRTG 1 cut(s) 377
MspI CCGG 1 cut(s) 133
NdeII GATC 3 cut(s) 57, 234, 315
NlaIII CATG 3 cut(s) 332, 349, 368
NlaIV GGNNCC 2 cut(s) 343, 409
NmuCI GTSAC 1 cut(s) 89
PagI TCATGA 2 cut(s) 328, 364
PdmI GAANNNNTTC 1 cut(s) 177
PfeI GAWTC 1 cut(s) 8
PleI GAGTC 3 cut(s) 86, 238, 433
PpsI GAGTC 3 cut(s) 86, 238, 433
PspN4I GGNNCC 2 cut(s) 343, 409
PspPI GGNCC 1 cut(s) 342
PsuI RGATCY 1 cut(s) 57
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
RseI CAYNNNNRTG 1 cut(s) 377
SaqAI TTAA 1 cut(s) 194
Sau3AI GATC 3 cut(s) 57, 234, 315
Sau96I GGNCC 1 cut(s) 342
SchI GAGTC 3 cut(s) 86, 238, 434
SetI ASST 7 cut(s) 53, 77, 87, 111, 257, 326, 336
SfaNI GCATC 2 cut(s) 192, 214
SfcI CTRYAG 1 cut(s) 306
SmiMI CAYNNNNRTG 1 cut(s) 377
Sse9I AATT 3 cut(s) 200, 391, 430
SspMI CTAG 2 cut(s) 45, 110
TaiI ACGT 1 cut(s) 87
TaqI TCGA 2 cut(s) 66, 237
TasI AATT 3 cut(s) 200, 391, 430
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 1 cut(s) 194
Tru9I TTAA 1 cut(s) 194
TseFI GTSAC 1 cut(s) 89
Tsp45I GTSAC 1 cut(s) 89
TspDTI ATGAA 4 cut(s) 48, 317, 362, 395
TspGWI ACGGA 1 cut(s) 328
XapI RAATTY 1 cut(s) 200
XmnI GAANNNNTTC 1 cut(s) 177
XspI CTAG 2 cut(s) 45, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.