Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002323.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

5024 .. 8249

Gene Structure 3226 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 501 bp

atgatcgtggaggctttggttctactatcttgcttagctttgtggtggctagctggcctcgggataacaaatgatggtgtggctcatggcggtgatgtctgctggtcaggatcatcaggtgtcgacaatactgatatggtgttgtctctaaggtggtttcctattgtcgaaccagatcctggtcatacaaaacttcgtctttcaaaggaaggcctagaggccattgaaagaataacaactccgattgcagctgttgcagtaagatttagattcgttttcctctgcatctgtagaactcacaatcttatcttcgttttagctaaaacttcaatttgtaagagcttatcattaagcgactatgatcttgagccatctagaatggcgctttacagatttggtaacacatcagctgctggcttttggtatgctttgggatacatggaagccaaacaaaggcttaagaggggtgataggattctaatgagtgtggctttggagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0006950 GO:0008150 GO:0009266 GO:0009314 GO:0009409 GO:0009416 GO:0009628 GO:0050896

KEGG Pathways

Metabolic & Signaling

ko00062 ko01110 map00062 map01110

Pfam Domains

Protein Families

ACP_syn_III_C FAE1_CUT1_RppA

Protein Analysis

166

Amino Acids

18.4

Weight (kDa)

7.65

Isoelectric Point (pI)

37.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	179
AccI	GTMKAC	1 cut(s)	123
AciI	CCGC	1 cut(s)	90
AclWI	GGATC	2 cut(s)	118, 170
AfiI	CCNNNNNNNGG	2 cut(s)	179, 453
AflII	CTTAAG	1 cut(s)	458
AgsI	TTSAA	3 cut(s)	204, 227, 330
AjnI	CCWGG	1 cut(s)	178
AluBI	AGCT	6 cut(s)	38, 53, 251, 320, 342, 410
AluI	AGCT	6 cut(s)	38, 53, 251, 320, 342, 410
Alw26I	GTCTC	1 cut(s)	150
AlwI	GGATC	2 cut(s)	118, 170
AlwNI	CAGNNNCTG	2 cut(s)	179, 413
Ama87I	CYCGRG	1 cut(s)	59
AoxI	GGCC	3 cut(s)	55, 211, 219
ApeKI	GCWGC	2 cut(s)	248, 410
AspLEI	GCGC	1 cut(s)	385
AsuHPI	GGTGA	2 cut(s)	104, 479
AsuNHI	GCTAGC	1 cut(s)	49
AvaI	CYCGRG	1 cut(s)	59
BbvI	GCAGC	2 cut(s)	260, 397
BccI	CCATC	2 cut(s)	68, 379
BciT130I	CCWGG	1 cut(s)	180
BciVI	GTATCC	1 cut(s)	428
BcoDI	GTCTC	1 cut(s)	150
BfaI	CTAG	3 cut(s)	50, 215, 375
BfmI	CTRYAG	1 cut(s)	289
BfoI	RGCGCY	1 cut(s)	386
BfrI	CTTAAG	1 cut(s)	458
BfuI	GTATCC	1 cut(s)	428
BisI	GCNGC	2 cut(s)	249, 411
BlpI	GCTNAGC	1 cut(s)	34
BlsI	GCNGC	2 cut(s)	250, 412
Bme1390I	CCNGG	1 cut(s)	180
BmeT110I	CYCGRG	1 cut(s)	59
BmrFI	CCNGG	1 cut(s)	180
BmsI	GCATC	1 cut(s)	294
BmtI	GCTAGC	1 cut(s)	53
Bpu1102I	GCTNAGC	1 cut(s)	34
BpuEI	CTTGAG	1 cut(s)	386
BsaJI	CCNNGG	1 cut(s)	58
Bsc4I	CCNNNNNNNGG	2 cut(s)	179, 453
BseBI	CCWGG	1 cut(s)	180
BseDI	CCNNGG	1 cut(s)	58
BseLI	CCNNNNNNNGG	2 cut(s)	179, 453
BseXI	GCAGC	2 cut(s)	260, 397
BshFI	GGCC	3 cut(s)	57, 213, 221
BsiHKCI	CYCGRG	1 cut(s)	59
BslI	CCNNNNNNNGG	2 cut(s)	179, 453
BsmAI	GTCTC	1 cut(s)	150
BsnI	GGCC	3 cut(s)	57, 213, 221
BsoBI	CYCGRG	1 cut(s)	59
Bsp143I	GATC	4 cut(s)	3, 110, 175, 361
Bsp1720I	GCTNAGC	1 cut(s)	34
BspACI	CCGC	1 cut(s)	90
BspANI	GGCC	3 cut(s)	57, 213, 221
BspOI	GCTAGC	1 cut(s)	53
BspPI	GGATC	2 cut(s)	118, 170
BspTI	CTTAAG	1 cut(s)	458
BssECI	CCNNGG	1 cut(s)	58
BssMI	GATC	4 cut(s)	3, 110, 175, 361
Bst2UI	CCWGG	1 cut(s)	180
BstAFI	CTTAAG	1 cut(s)	458
BstAPI	GCANNNNNTGC	1 cut(s)	254
BstC8I	GCNNGC	3 cut(s)	51, 55, 415
BstDEI	CTNAG	2 cut(s)	34, 149
BstH2I	RGCGCY	1 cut(s)	386
BstHHI	GCGC	1 cut(s)	385
BstKTI	GATC	4 cut(s)	6, 113, 178, 364
BstMAI	GTCTC	1 cut(s)	150
BstMBI	GATC	4 cut(s)	3, 110, 175, 361
BstMWI	GCNNNNNNNGC	1 cut(s)	254
BstNI	CCWGG	1 cut(s)	180
BstSCI	CCNGG	1 cut(s)	178
BstSFI	CTRYAG	1 cut(s)	289
BstV1I	GCAGC	2 cut(s)	260, 397
BstX2I	RGATCY	1 cut(s)	175
BstYI	RGATCY	1 cut(s)	175
BsuI	GTATCC	1 cut(s)	428
BsuRI	GGCC	3 cut(s)	57, 213, 221
Cac8I	GCNNGC	3 cut(s)	51, 55, 415
CaiI	CAGNNNCTG	2 cut(s)	179, 413
CfoI	GCGC	1 cut(s)	385
CviAII	CATG	2 cut(s)	86, 439
DdeI	CTNAG	2 cut(s)	34, 149
DpnI	GATC	4 cut(s)	5, 112, 177, 363
DpnII	GATC	4 cut(s)	3, 110, 175, 361
Eco147I	AGGCCT	1 cut(s)	213
Eco88I	CYCGRG	1 cut(s)	59
EcoRII	CCWGG	1 cut(s)	178
FaeI	CATG	2 cut(s)	89, 442
FaiI	YATR	6 cut(s)	87, 137, 186, 360, 426, 440
FatI	CATG	2 cut(s)	85, 438
FblI	GTMKAC	1 cut(s)	123
Fnu4HI	GCNGC	2 cut(s)	249, 411
Fsp4HI	GCNGC	2 cut(s)	249, 411
FspBI	CTAG	3 cut(s)	50, 215, 375
GlaI	GCGC	1 cut(s)	384
GluI	GCNGC	2 cut(s)	249, 411
HaeII	RGCGCY	1 cut(s)	386
HaeIII	GGCC	3 cut(s)	57, 213, 221
HhaI	GCGC	1 cut(s)	385
Hin1II	CATG	2 cut(s)	89, 442
Hin6I	GCGC	1 cut(s)	383
HinP1I	GCGC	1 cut(s)	383
HincII	GTYRAC	1 cut(s)	124
HindII	GTYRAC	1 cut(s)	124
HinfI	GANTC	2 cut(s)	270, 475
HphI	GGTGA	2 cut(s)	104, 479
Hpy166II	GTNNAC	1 cut(s)	124
Hpy188I	TCNGA	1 cut(s)	243
Hpy188III	TCNNGA	4 cut(s)	61, 108, 365, 375
Hpy8I	GTNNAC	1 cut(s)	124
HpyAV	CCTTC	1 cut(s)	203
HpyCH4V	TGCA	3 cut(s)	248, 257, 285
HpyF10VI	GCNNNNNNNGC	1 cut(s)	254
HpyF3I	CTNAG	2 cut(s)	34, 149
Hsp92II	CATG	2 cut(s)	89, 442
HspAI	GCGC	1 cut(s)	383
Kzo9I	GATC	4 cut(s)	3, 110, 175, 361
LpnPI	CCDG	8 cut(s)	39, 88, 93, 102, 165, 186, 192, 399
Lsp1109I	GCAGC	2 cut(s)	260, 397
LweI	GCATC	1 cut(s)	294
MaeI	CTAG	3 cut(s)	50, 215, 375
MaeIII	GTNAC	1 cut(s)	398
MalI	GATC	4 cut(s)	5, 112, 177, 363
MboI	GATC	4 cut(s)	3, 110, 175, 361
MboII	GAAGA	1 cut(s)	301
MflI	RGATCY	1 cut(s)	175
MluCI	AATT	1 cut(s)	330
MnlI	CCTC	5 cut(s)	4, 68, 211, 290, 456
MseI	TTAA	2 cut(s)	350, 459
MslI	CAYNNNNRTG	1 cut(s)	90
MspA1I	CMGCKG	2 cut(s)	251, 410
MspCI	CTTAAG	1 cut(s)	458
MspR9I	CCNGG	1 cut(s)	180
MvaI	CCWGG	1 cut(s)	180
MwoI	GCNNNNNNNGC	1 cut(s)	254
NdeII	GATC	4 cut(s)	3, 110, 175, 361
NheI	GCTAGC	1 cut(s)	49
NlaIII	CATG	2 cut(s)	89, 442
PceI	AGGCCT	1 cut(s)	213
PfeI	GAWTC	2 cut(s)	270, 475
PflMI	CCANNNNNTGG	1 cut(s)	179
PkrI	GCNGC	2 cut(s)	250, 412
Psp6I	CCWGG	1 cut(s)	178
PspGI	CCWGG	1 cut(s)	178
PstNI	CAGNNNCTG	2 cut(s)	179, 413
PsuI	RGATCY	1 cut(s)	175
PvuII	CAGCTG	2 cut(s)	251, 410
RseI	CAYNNNNRTG	1 cut(s)	90
SalI	GTCGAC	1 cut(s)	122
SaqAI	TTAA	2 cut(s)	350, 459
SatI	GCNGC	2 cut(s)	249, 411
Sau3AI	GATC	4 cut(s)	3, 110, 175, 361
ScrFI	CCNGG	1 cut(s)	180
SetI	ASST	8 cut(s)	40, 55, 121, 155, 253, 322, 344, 412
SfaNI	GCATC	1 cut(s)	294
SfcI	CTRYAG	1 cut(s)	289
SmiMI	CAYNNNNRTG	1 cut(s)	90
SmlI	CTYRAG	2 cut(s)	365, 458
SmoI	CTYRAG	2 cut(s)	365, 458
Sse9I	AATT	1 cut(s)	330
SseBI	AGGCCT	1 cut(s)	213
SsiI	CCGC	1 cut(s)	90
SspMI	CTAG	3 cut(s)	50, 215, 375
StuI	AGGCCT	1 cut(s)	213
StyD4I	CCNGG	1 cut(s)	178
TaqI	TCGA	2 cut(s)	123, 168
TasI	AATT	1 cut(s)	330
TfiI	GAWTC	2 cut(s)	270, 475
Tru1I	TTAA	2 cut(s)	350, 459
Tru9I	TTAA	2 cut(s)	350, 459
TseI	GCWGC	2 cut(s)	248, 410
Van91I	CCANNNNNTGG	1 cut(s)	179
Vha464I	CTTAAG	1 cut(s)	458
XbaI	TCTAGA	1 cut(s)	374
XmiI	GTMKAC	1 cut(s)	123
XspI	CTAG	3 cut(s)	50, 215, 375

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.