Rmu_sc0002539.1_g000098

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002539.1
N/A
Physical Location & Seq
Reverse (-)
371857 .. 375568
3712 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1506 bp
atggatgacccttgcatttttcgattagatatccaacaactgcctttccccatttactgctgcttggctgttaatgataaggaaaccatttctgttaagttcctccagcagttcattcttgatcttcctcgtctctggcagctgatcaagccctcctcgtctggtggcgccctcattctagcgctggtctttggccgcgctggtgtggtgtggttgctgccagacgggctatgtatgtttcccggtggtatggagtttgggtggttgcattcagtgtctctctcgtctaggtggcggcgatggttcgttggtttggcttcttgcttcttgccttggttacggccaggatggcagtcatggctggctgggctgctctgggttttgatcaatggtggaggggatcgatctcggtggccagatagtttgctatgtgacttgcctgtctgtgtgccagatctagactgtggcggattgtgggggattgtggtggggttcatgggagcctggtggtggtttggcgttttggggtggagaaatgttcatgggtgggggcagatctccgtccagcaagggtggatctgtagaggcgagttcgggttgggggaggtttcatgcggtggttttcctattcagggcccatcgaggtttagagttggtagggagaagttagtcaccgaccatactattccggcaacggggatttccaactggtcagggtcgtttactcggcaacaggacagggtttgtgacggtggtcttttggtgtcatgccatgtaagtggtgtcattcccgaggacgaggactatttggttcaattctggtttacttttggtgtcgagtcgctgacgagcgatcctttacatgtggtcttggcggttgattacgaggtattactaaaactttcggggttatatgatcaatgtagccttggaaataggctcgctgacgagcgatccttttcatgtggtcttgtaattttggactcggtgttgaagaggacgcagtcttcttggcggttgattacgaggcaattcttcaaggcagatcagaaaaaagaagaagaaacgagccaccttcactttttcttccatgacattcttagtggcaaaactccaagtgctgtcagaattatcggcgggccaaacagcagcctctccagcttcggttccaccttgatgattgatgatgcgctcactgaaaagcaagatcccacatcgaagatcatcggacgagcacaagggttttactcagtggctgcacaacaggagattgcactgcttatggtcatgagttttcagtttgtggagggtcagtacaaggggagtagcatcagcattcttgggaggaatccagtgatgaacgatgtcagggagatgccgattgttggaggcaccggattgtttcggtttgctcgtggctatgttttagcacatacggtttggtttgatgctaatacaggagacgccattgttgagtacaatgtgtatgtgtcacagacctcgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

501

Amino Acids

55.81

Weight (kDa)

5.75

Isoelectric Point (pI)

44.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 357 - 497 5.3e-55 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 440
AccB1I GGYRCC 2 cut(s) 167, 1391
AccII CGCG 1 cut(s) 198
AciI CCGC 7 cut(s) 196, 295, 468, 615, 875, 1015, 1137
AclWI GGATC 5 cut(s) 408, 584, 848, 948, 1202
AcoI YGGCCR 3 cut(s) 193, 341, 413
AcyI GRCGYC 2 cut(s) 168, 1464
AfaI GTAC 2 cut(s) 1316, 1478
AfeI AGCGCT 1 cut(s) 183
AfiI CCNNNNNNNGG 4 cut(s) 510, 632, 695, 1385
AflIII ACRYGT 1 cut(s) 862
AgsI TTSAA 3 cut(s) 815, 994, 1039
AjnI CCWGG 2 cut(s) 343, 503
AluBI AGCT 2 cut(s) 142, 1161
AluI AGCT 2 cut(s) 142, 1161
Alw21I GWGCWC 1 cut(s) 1237
Alw26I GTCTC 3 cut(s) 137, 282, 1455
AlwI GGATC 5 cut(s) 408, 584, 848, 948, 1202
AlwNI CAGNNNCTG 1 cut(s) 1256
Ama87I CYCGRG 1 cut(s) 791
Aor51HI AGCGCT 1 cut(s) 183
AoxI GGCC 5 cut(s) 193, 341, 413, 634, 1139
ApaI GGGCCC 1 cut(s) 638
ApeKI GCWGC 6 cut(s) 60, 139, 217, 370, 1149, 1256
AspLEI GCGC 4 cut(s) 170, 184, 200, 1192
AspS9I GGNCC 3 cut(s) 634, 635, 1139
AsuC2I CCSGG 1 cut(s) 243
AsuHPI GGTGA 1 cut(s) 664
AvaI CYCGRG 1 cut(s) 791
BaeGI GKGCMC 1 cut(s) 638
BalI TGGCCA 1 cut(s) 415
BanI GGYRCC 2 cut(s) 167, 1391
BanII GRGCYC 1 cut(s) 638
BauI CACGAG 2 cut(s) 1413, 1501
BbsI GAAGAC 1 cut(s) 999
Bbv12I GWGCWC 1 cut(s) 1237
BbvI GCAGC 6 cut(s) 47, 151, 204, 357, 1161, 1243
BccI CCATC 3 cut(s) 294, 342, 646
BceAI ACGGC 1 cut(s) 356
BciT130I CCWGG 2 cut(s) 345, 505
BclI TGATCA 3 cut(s) 144, 384, 916
BcnI CCSGG 1 cut(s) 243
BcoDI GTCTC 3 cut(s) 137, 282, 1455
BfaI CTAG 3 cut(s) 179, 288, 458
BfmI CTRYAG 1 cut(s) 580
BfoI RGCGCY 2 cut(s) 171, 185
BglI GCCNNNNNGGC 2 cut(s) 226, 349
BglII AGATCT 2 cut(s) 454, 555
BisI GCNGC 8 cut(s) 61, 140, 196, 218, 296, 371, 1150, 1257
BlsI GCNGC 8 cut(s) 62, 141, 197, 219, 297, 372, 1151, 1258
Bme1390I CCNGG 3 cut(s) 243, 345, 505
BmeT110I CYCGRG 1 cut(s) 791
BmgT120I GGNCC 3 cut(s) 634, 635, 1139
BmiI GGNNCC 5 cut(s) 169, 502, 636, 1168, 1393
BmrFI CCNGG 3 cut(s) 243, 345, 505
BmsI GCATC 4 cut(s) 1177, 1338, 1365, 1438
BoxI GACNNNNGTC 1 cut(s) 753
BpiI GAAGAC 1 cut(s) 999
BpmI CTGGAG 2 cut(s) 89, 1141
BpuMI CCSGG 1 cut(s) 243
Bsa29I ATCGAT 1 cut(s) 403
BsaHI GRCGYC 2 cut(s) 168, 1464
BsaJI CCNNGG 3 cut(s) 332, 792, 928
BsaWI WCCGGW 1 cut(s) 1394
BsaXI ACNNNNNCTCC 4 cut(s) 245, 275, 1298, 1328
Bsc4I CCNNNNNNNGG 4 cut(s) 510, 632, 695, 1385
Bse1I ACTGG 2 cut(s) 713, 1352
BseBI CCWGG 2 cut(s) 345, 505
BseCI ATCGAT 1 cut(s) 403
BseDI CCNNGG 3 cut(s) 332, 792, 928
BseGI GGATG 2 cut(s) 10, 353
BseLI CCNNNNNNNGG 4 cut(s) 510, 632, 695, 1385
BseMII CTCAG 1 cut(s) 1263
BseNI ACTGG 2 cut(s) 713, 1352
BseRI GAGGAG 1 cut(s) 145
BseSI GKGCMC 1 cut(s) 638
BseXI GCAGC 6 cut(s) 47, 151, 204, 357, 1161, 1243
BseYI CCCAGC 1 cut(s) 365
BsgI GTGCAG 1 cut(s) 1242
Bsh1236I CGCG 1 cut(s) 198
BshFI GGCC 5 cut(s) 195, 343, 415, 636, 1141
BshNI GGYRCC 2 cut(s) 167, 1391
BshVI ATCGAT 1 cut(s) 403
BsiHKAI GWGCWC 1 cut(s) 1237
BsiHKCI CYCGRG 1 cut(s) 791
BsiSI CCGG 3 cut(s) 243, 689, 1395
BslI CCNNNNNNNGG 4 cut(s) 510, 632, 695, 1385
BsmAI GTCTC 3 cut(s) 137, 282, 1455
BsmBI CGTCTC 2 cut(s) 137, 1455
BsmI GAATGC 2 cut(s) 268, 1335
BsnI GGCC 5 cut(s) 195, 343, 415, 636, 1141
BsoBI CYCGRG 1 cut(s) 791
Bsp120I GGGCCC 1 cut(s) 634
Bsp1286I GDGCHC 2 cut(s) 638, 1237
BspACI CCGC 7 cut(s) 196, 295, 468, 615, 875, 1015, 1137
BspANI GGCC 5 cut(s) 195, 343, 415, 636, 1141
BspCNI CTCAG 1 cut(s) 1262
BspDI ATCGAT 1 cut(s) 403
BspFNI CGCG 1 cut(s) 198
BspHI TCATGA 1 cut(s) 1287
BspLI GGNNCC 5 cut(s) 169, 502, 636, 1168, 1393
BspPI GGATC 5 cut(s) 408, 584, 848, 948, 1202
BspT107I GGYRCC 2 cut(s) 167, 1391
BsrI ACTGG 2 cut(s) 713, 1352
BssECI CCNNGG 3 cut(s) 332, 792, 928
BssNI GRCGYC 2 cut(s) 168, 1464
BssSI CACGAG 2 cut(s) 1413, 1501
BssT1I CCWWGG 2 cut(s) 332, 928
Bst2BI CACGAG 2 cut(s) 1413, 1501
Bst2UI CCWGG 2 cut(s) 345, 505
Bst4CI ACNGT 3 cut(s) 464, 752, 1438
Bst6I CTCTTC 1 cut(s) 989
BstACI GRCGYC 2 cut(s) 168, 1464
BstC8I GCNNGC 3 cut(s) 363, 942, 1139
BstDEI CTNAG 2 cut(s) 1100, 1249
BstF5I GGATG 2 cut(s) 10, 353
BstFNI CGCG 1 cut(s) 198
BstH2I RGCGCY 2 cut(s) 171, 185
BstHHI GCGC 4 cut(s) 170, 184, 200, 1192
BstMAI GTCTC 3 cut(s) 137, 282, 1455
BstMWI GCNNNNNNNGC 6 cut(s) 148, 226, 349, 358, 367, 1158
BstNI CCWGG 2 cut(s) 345, 505
BstNSI RCATGY 1 cut(s) 866
BstPAI GACNNNNGTC 1 cut(s) 753
BstSCI CCNGG 3 cut(s) 241, 343, 503
BstSFI CTRYAG 1 cut(s) 580
BstSLI GKGCMC 1 cut(s) 638
BstUI CGCG 1 cut(s) 198
BstV1I GCAGC 6 cut(s) 47, 151, 204, 357, 1161, 1243
BstV2I GAAGAC 1 cut(s) 999
BstX2I RGATCY 4 cut(s) 454, 555, 576, 1207
BstXI CCANNNNNNTGG 1 cut(s) 779
BstYI RGATCY 4 cut(s) 454, 555, 576, 1207
Bsu15I ATCGAT 1 cut(s) 403
BsuRI GGCC 5 cut(s) 195, 343, 415, 636, 1141
BsuTUI ATCGAT 1 cut(s) 403
BtgZI GCGATG 1 cut(s) 313
BtsCI GGATG 2 cut(s) 10, 353
BtsI GCAGTG 1 cut(s) 1274
BtsIMutI CAGTG 5 cut(s) 279, 1194, 1257, 1274, 1359
Cac8I GCNNGC 3 cut(s) 363, 942, 1139
CaiI CAGNNNCTG 1 cut(s) 1256
CciI TCATGA 1 cut(s) 1287
CfoI GCGC 4 cut(s) 170, 184, 200, 1192
Cfr13I GGNCC 3 cut(s) 634, 635, 1139
ClaI ATCGAT 1 cut(s) 403
CseI GACGC 2 cut(s) 1009, 1472
Csp6I GTAC 2 cut(s) 1315, 1477
CviQI GTAC 2 cut(s) 1315, 1477
DdeI CTNAG 2 cut(s) 1100, 1249
DinI GGCGCC 1 cut(s) 169
DrdI GACNNNNNNGTC 1 cut(s) 440
DseDI GACNNNNNNGTC 1 cut(s) 440
EaeI YGGCCR 3 cut(s) 193, 341, 413
Eam1104I CTCTTC 1 cut(s) 989
EarI CTCTTC 1 cut(s) 989
EciI GGCGGA 1 cut(s) 483
Eco130I CCWWGG 2 cut(s) 332, 928
Eco24I GRGCYC 1 cut(s) 638
Eco32I GATATC 1 cut(s) 31
Eco47III AGCGCT 1 cut(s) 183
Eco88I CYCGRG 1 cut(s) 791
EcoO109I RGGNCCY 1 cut(s) 634
EcoRII CCWGG 2 cut(s) 343, 503
EcoRV GATATC 1 cut(s) 31
EcoT14I CCWWGG 2 cut(s) 332, 928
EcoT38I GRGCYC 1 cut(s) 638
EgeI GGCGCC 1 cut(s) 169
EheI GGCGCC 1 cut(s) 169
ErhI CCWWGG 2 cut(s) 332, 928
Esp3I CGTCTC 2 cut(s) 137, 1455
FauI CCCGC 1 cut(s) 1130
FbaI TGATCA 3 cut(s) 144, 384, 916
Fnu4HI GCNGC 8 cut(s) 61, 140, 196, 218, 296, 371, 1150, 1257
FokI GGATG 2 cut(s) 17, 360
FriOI GRGCYC 1 cut(s) 638
Fsp4HI GCNGC 8 cut(s) 61, 140, 196, 218, 296, 371, 1150, 1257
FspBI CTAG 3 cut(s) 179, 288, 458
GlaI GCGC 4 cut(s) 169, 183, 199, 1191
GluI GCNGC 8 cut(s) 61, 140, 196, 218, 296, 371, 1150, 1257
GsaI CCCAGC 1 cut(s) 369
GsuI CTGGAG 2 cut(s) 89, 1141
HaeII RGCGCY 2 cut(s) 171, 185
HaeIII GGCC 5 cut(s) 195, 343, 415, 636, 1141
HapII CCGG 3 cut(s) 243, 689, 1395
HgaI GACGC 2 cut(s) 1009, 1472
HhaI GCGC 4 cut(s) 170, 184, 200, 1192
Hin1I GRCGYC 2 cut(s) 168, 1464
Hin6I GCGC 4 cut(s) 168, 182, 198, 1190
HinP1I GCGC 4 cut(s) 168, 182, 198, 1190
HinfI GANTC 3 cut(s) 839, 983, 1348
HpaII CCGG 3 cut(s) 243, 689, 1395
HphI GGTGA 1 cut(s) 664
Hpy166II GTNNAC 2 cut(s) 723, 825
Hpy188I TCNGA 3 cut(s) 1050, 1127, 1229
Hpy188III TCNNGA 5 cut(s) 119, 458, 791, 1288, 1503
Hpy8I GTNNAC 2 cut(s) 723, 825
HpyAV CCTTC 1 cut(s) 1085
HpyCH4III ACNGT 3 cut(s) 464, 752, 1438
HpyCH4V TGCA 4 cut(s) 15, 268, 1259, 1274
HpyF10VI GCNNNNNNNGC 6 cut(s) 148, 226, 349, 358, 367, 1158
HpyF3I CTNAG 2 cut(s) 1100, 1249
Hsp92I GRCGYC 2 cut(s) 168, 1464
HspAI GCGC 4 cut(s) 168, 182, 198, 1190
KasI GGCGCC 1 cut(s) 167
Ksp22I TGATCA 3 cut(s) 144, 384, 916
LmnI GCTCC 1 cut(s) 500
Lsp1109I GCAGC 6 cut(s) 47, 151, 204, 357, 1161, 1243
LweI GCATC 4 cut(s) 1177, 1338, 1365, 1438
MaeI CTAG 3 cut(s) 179, 288, 458
MaeIII GTNAC 5 cut(s) 336, 431, 670, 746, 1491
MboII GAAGA 8 cut(s) 116, 999, 1006, 1027, 1070, 1073, 1078, 1231
MflI RGATCY 4 cut(s) 454, 555, 576, 1207
MhlI GDGCHC 2 cut(s) 638, 1237
MlsI TGGCCA 1 cut(s) 415
MluCI AATT 4 cut(s) 815, 975, 1031, 1128
MluNI TGGCCA 1 cut(s) 415
Mly113I GGCGCC 1 cut(s) 168
MlyI GAGTC 2 cut(s) 848, 977
MmeI TCCRAC 3 cut(s) 58, 729, 1366
Mox20I TGGCCA 1 cut(s) 415
MscI TGGCCA 1 cut(s) 415
MseI TTAA 2 cut(s) 72, 96
MslI CAYNNNNRTG 2 cut(s) 777, 1175
Msp20I TGGCCA 1 cut(s) 415
MspA1I CMGCKG 1 cut(s) 142
MspI CCGG 3 cut(s) 243, 689, 1395
MspR9I CCNGG 3 cut(s) 243, 345, 505
Mva1269I GAATGC 2 cut(s) 268, 1335
MvaI CCWGG 2 cut(s) 345, 505
MvnI CGCG 1 cut(s) 198
MwoI GCNNNNNNNGC 6 cut(s) 148, 226, 349, 358, 367, 1158
NarI GGCGCC 1 cut(s) 168
NciI CCSGG 1 cut(s) 243
NlaIV GGNNCC 5 cut(s) 169, 502, 636, 1168, 1393
NmeAIII GCCGAG 1 cut(s) 706
NmuCI GTSAC 4 cut(s) 431, 670, 746, 1491
NspI RCATGY 1 cut(s) 866
PagI TCATGA 1 cut(s) 1287
PciI ACATGT 1 cut(s) 862
PcsI WCGNNNNNNNCGW 1 cut(s) 1411
PctI GAATGC 2 cut(s) 268, 1335
PfeI GAWTC 1 cut(s) 1348
PflFI GACNNNGTC 1 cut(s) 1003
PkrI GCNGC 8 cut(s) 62, 141, 197, 219, 297, 372, 1151, 1258
PleI GAGTC 2 cut(s) 847, 977
PluTI GGCGCC 1 cut(s) 171
PpsI GAGTC 2 cut(s) 847, 977
PscI ACATGT 1 cut(s) 862
PshAI GACNNNNGTC 1 cut(s) 753
Psp6I CCWGG 2 cut(s) 343, 503
PspFI CCCAGC 1 cut(s) 365
PspGI CCWGG 2 cut(s) 343, 503
PspN4I GGNNCC 5 cut(s) 169, 502, 636, 1168, 1393
PspOMI GGGCCC 1 cut(s) 634
PspPI GGNCC 3 cut(s) 634, 635, 1139
PstNI CAGNNNCTG 1 cut(s) 1256
PsuI RGATCY 4 cut(s) 454, 555, 576, 1207
PsyI GACNNNGTC 1 cut(s) 1003
PvuII CAGCTG 1 cut(s) 142
RsaI GTAC 2 cut(s) 1316, 1478
RsaNI GTAC 2 cut(s) 1315, 1477
RseI CAYNNNNRTG 2 cut(s) 777, 1175
SaqAI TTAA 2 cut(s) 72, 96
SatI GCNGC 8 cut(s) 61, 140, 196, 218, 296, 371, 1150, 1257
Sau96I GGNCC 3 cut(s) 634, 635, 1139
SchI GAGTC 2 cut(s) 848, 977
ScrFI CCNGG 3 cut(s) 243, 345, 505
SduI GDGCHC 2 cut(s) 638, 1237
SetI ASST 9 cut(s) 144, 293, 609, 647, 891, 1077, 1163, 1175, 1502
SfaNI GCATC 4 cut(s) 1177, 1338, 1365, 1438
SfcI CTRYAG 1 cut(s) 580
SfoI GGCGCC 1 cut(s) 169
SmiMI CAYNNNNRTG 2 cut(s) 777, 1175
Sse9I AATT 4 cut(s) 815, 975, 1031, 1128
SsiI CCGC 7 cut(s) 196, 295, 468, 615, 875, 1015, 1137
SspDI GGCGCC 1 cut(s) 167
SspMI CTAG 3 cut(s) 179, 288, 458
StyD4I CCNGG 3 cut(s) 241, 343, 503
StyI CCWWGG 2 cut(s) 332, 928
TaaI ACNGT 3 cut(s) 464, 752, 1438
TaqI TCGA 5 cut(s) 22, 403, 641, 837, 1217
TasI AATT 4 cut(s) 815, 975, 1031, 1128
TatI WGTACW 2 cut(s) 1314, 1476
TauI GCSGC 2 cut(s) 198, 298
TfiI GAWTC 1 cut(s) 1348
Tru1I TTAA 2 cut(s) 72, 96
Tru9I TTAA 2 cut(s) 72, 96
TscAI CASTG 5 cut(s) 279, 1201, 1257, 1281, 1359
TseFI GTSAC 4 cut(s) 431, 670, 746, 1491
TseI GCWGC 6 cut(s) 60, 139, 217, 370, 1149, 1256
Tsp45I GTSAC 4 cut(s) 431, 670, 746, 1491
TspDTI ATGAA 6 cut(s) 103, 484, 530, 600, 951, 1373
TspGWI ACGGA 1 cut(s) 550
TspRI CASTG 5 cut(s) 279, 1201, 1257, 1281, 1359
Tth111I GACNNNGTC 1 cut(s) 1003
XbaI TCTAGA 1 cut(s) 457
XceI RCATGY 1 cut(s) 866
XspI CTAG 3 cut(s) 179, 288, 458
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.