Rmu_sc0002811.1_g000009
ERF Family

Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002811.1
N/A
Physical Location & Seq
Reverse (-)
28883 .. 29357
475 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 387 bp
atggggaaggaggaaaaaatcaacaatcattatctttcctctctccggcaaggtctccgaccgacctccagaaacctccagtgggtctccagccgactctcggtcaactccgacgatgtcataaaagccactgtcaccaacaacaaatgttactttgccatagtcgtcacgcttgccatcccgacgctggtgatgagcgtagtagcactttgttttttacctgacactccaaattcaattctacagaaaagttatcctgagaaggccaaaacaatgttacaaaaggttcgtggcacagaaaacgtggacgatgagttccaagaccttattaatgcaagtgatgctgctgcgaagaaagtggagaatccatggagaaacatagcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sugar_tr

Protein Analysis

128

Amino Acids

14.32

Weight (kDa)

8.95

Isoelectric Point (pI)

42.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sugar_tr PF00083 50 - 126 1.7e-08 Sugar (and other) transporter
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 232
AfiI CCNNNNNNNGG 4 cut(s) 45, 82, 100, 187
AgsI TTSAA 1 cut(s) 237
AhdI GACNNNNNGTC 1 cut(s) 101
AloI GAACNNNNNNTCC 2 cut(s) 299, 331
Alw26I GTCTC 2 cut(s) 59, 91
AoxI GGCC 1 cut(s) 264
ApeKI GCWGC 2 cut(s) 344, 347
ApoI RAATTY 1 cut(s) 232
AseI ATTAAT 1 cut(s) 330
AsuHPI GGTGA 2 cut(s) 127, 202
BbvI GCAGC 2 cut(s) 331, 334
BccI CCATC 1 cut(s) 185
BcoDI GTCTC 2 cut(s) 59, 91
BfmI CTRYAG 1 cut(s) 242
BisI GCNGC 2 cut(s) 345, 348
BlsI GCNGC 2 cut(s) 346, 349
BmeRI GACNNNNNGTC 1 cut(s) 101
BmsI GCATC 1 cut(s) 331
BpmI CTGGAG 3 cut(s) 52, 62, 73
BsaI GGTCTC 2 cut(s) 59, 91
BsaJI CCNNGG 1 cut(s) 368
Bsc4I CCNNNNNNNGG 4 cut(s) 45, 82, 100, 187
Bse1I ACTGG 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 368
BseGI GGATG 1 cut(s) 177
BseLI CCNNNNNNNGG 4 cut(s) 45, 82, 100, 187
BseMII CTCAG 1 cut(s) 249
BseNI ACTGG 1 cut(s) 79
BseXI GCAGC 2 cut(s) 331, 334
Bsh1285I CGRYCG 1 cut(s) 62
BshFI GGCC 1 cut(s) 266
BsiEI CGRYCG 1 cut(s) 62
BsiSI CCGG 1 cut(s) 46
BslI CCNNNNNNNGG 4 cut(s) 45, 82, 100, 187
BsmAI GTCTC 2 cut(s) 59, 91
BsnI GGCC 1 cut(s) 266
Bso31I GGTCTC 2 cut(s) 59, 91
Bsp19I CCATGG 1 cut(s) 368
BspANI GGCC 1 cut(s) 266
BspCNI CTCAG 1 cut(s) 250
BspTNI GGTCTC 2 cut(s) 59, 91
BsrI ACTGG 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 368
BssT1I CCWWGG 1 cut(s) 368
Bst4CI ACNGT 1 cut(s) 133
BstAPI GCANNNNNTGC 1 cut(s) 341
BstC8I GCNNGC 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 258
BstDSI CCRYGG 1 cut(s) 368
BstF5I GGATG 1 cut(s) 177
BstMAI GTCTC 2 cut(s) 59, 91
BstMCI CGRYCG 1 cut(s) 62
BstMWI GCNNNNNNNGC 1 cut(s) 341
BstSFI CTRYAG 1 cut(s) 242
BstV1I GCAGC 2 cut(s) 331, 334
BsuRI GGCC 1 cut(s) 266
BtgI CCRYGG 1 cut(s) 368
BtsCI GGATG 1 cut(s) 177
BtsIMutI CAGTG 2 cut(s) 86, 129
Cac8I GCNNGC 1 cut(s) 174
CseI GACGC 1 cut(s) 193
CviAII CATG 1 cut(s) 369
CviJI RGCY 3 cut(s) 93, 128, 266
CviKI_1 RGCY 3 cut(s) 93, 128, 266
DdeI CTNAG 1 cut(s) 258
DriI GACNNNNNGTC 1 cut(s) 101
Eam1105I GACNNNNNGTC 1 cut(s) 101
Eco130I CCWWGG 1 cut(s) 368
Eco31I GGTCTC 2 cut(s) 59, 91
EcoT14I CCWWGG 1 cut(s) 368
ErhI CCWWGG 1 cut(s) 368
FaeI CATG 1 cut(s) 372
FaiI YATR 5 cut(s) 122, 161, 370, 380, 385
FatI CATG 1 cut(s) 368
Fnu4HI GCNGC 2 cut(s) 345, 348
FokI GGATG 1 cut(s) 164
Fsp4HI GCNGC 2 cut(s) 345, 348
GluI GCNGC 2 cut(s) 345, 348
GsuI CTGGAG 3 cut(s) 52, 62, 73
HaeIII GGCC 1 cut(s) 266
HapII CCGG 1 cut(s) 46
HgaI GACGC 1 cut(s) 193
Hin1II CATG 1 cut(s) 372
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HinfI GANTC 2 cut(s) 96, 364
HpaII CCGG 1 cut(s) 46
HphI GGTGA 2 cut(s) 127, 202
Hpy166II GTNNAC 2 cut(s) 106, 307
Hpy188I TCNGA 2 cut(s) 59, 112
Hpy188III TCNNGA 3 cut(s) 69, 181, 257
Hpy8I GTNNAC 2 cut(s) 106, 307
Hpy99I CGWCG 2 cut(s) 116, 187
HpyAV CCTTC 1 cut(s) 256
HpyCH4III ACNGT 1 cut(s) 133
HpyCH4IV ACGT 1 cut(s) 303
HpyCH4V TGCA 1 cut(s) 335
HpyF10VI GCNNNNNNNGC 1 cut(s) 341
HpyF3I CTNAG 1 cut(s) 258
HpySE526I ACGT 1 cut(s) 303
Hsp92II CATG 1 cut(s) 372
LpnPI CCDG 7 cut(s) 59, 82, 92, 103, 173, 234, 270
Lsp1109I GCAGC 2 cut(s) 331, 334
LweI GCATC 1 cut(s) 331
MaeII ACGT 1 cut(s) 303
MaeIII GTNAC 4 cut(s) 133, 149, 166, 276
MboII GAAGA 1 cut(s) 364
MluCI AATT 2 cut(s) 232, 237
MlyI GAGTC 1 cut(s) 90
MmeI TCCRAC 2 cut(s) 82, 135
MnlI CCTC 4 cut(s) 4, 49, 76, 86
MseI TTAA 1 cut(s) 330
MspI CCGG 1 cut(s) 46
MwoI GCNNNNNNNGC 1 cut(s) 341
NcoI CCATGG 1 cut(s) 368
NlaIII CATG 1 cut(s) 372
NmuCI GTSAC 2 cut(s) 133, 166
PfeI GAWTC 1 cut(s) 364
PflFI GACNNNGTC 1 cut(s) 116
PkrI GCNGC 2 cut(s) 346, 349
PleI GAGTC 1 cut(s) 90
PpsI GAGTC 1 cut(s) 90
PshBI ATTAAT 1 cut(s) 330
PsyI GACNNNGTC 1 cut(s) 116
SaqAI TTAA 1 cut(s) 330
SatI GCNGC 2 cut(s) 345, 348
SchI GAGTC 1 cut(s) 90
SetI ASST 7 cut(s) 55, 68, 78, 223, 288, 306, 327
SfaNI GCATC 1 cut(s) 331
SfcI CTRYAG 1 cut(s) 242
Sse9I AATT 2 cut(s) 232, 237
StyI CCWWGG 1 cut(s) 368
TaaI ACNGT 1 cut(s) 133
TaiI ACGT 1 cut(s) 306
TaqII GACCGA 2 cut(s) 76, 91
TasI AATT 2 cut(s) 232, 237
TfiI GAWTC 1 cut(s) 364
Tru1I TTAA 1 cut(s) 330
Tru9I TTAA 1 cut(s) 330
TscAI CASTG 2 cut(s) 86, 136
TseFI GTSAC 2 cut(s) 133, 166
TseI GCWGC 2 cut(s) 344, 347
Tsp45I GTSAC 2 cut(s) 133, 166
TspRI CASTG 2 cut(s) 86, 136
Tth111I GACNNNGTC 1 cut(s) 116
VspI ATTAAT 1 cut(s) 330
XapI RAATTY 1 cut(s) 232
XcmI CCANNNNNNNNNTGG 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.