Rmu_sc0002851.1_g000005

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002851.1
N/A
Physical Location & Seq
Forward (+)
21816 .. 22702
887 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 375 bp
atgtcaacttcccagggacccactgccacgtcagcattggtcagcgacaggtcaacgccagttgaccaattccggtcaactttccggtgggttcgtgatgttcgccagcatctcaaggtcgatggaatcctggatacgattctcaagcctagccaggacgtgctaactattgagcaagctcaagctttggaagcagatagagcagccttagaggcaaataaggcaaaagctgtcatcctaatgacttgtcatatggatgattcgctccagtacgagtgtatgaataaagaagaccccaaaaggttatgggtctcactcgaagaaagatttagcaatgtccgtgactccctgcttcctgacctagaaattagatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

124

Amino Acids

14.1

Weight (kDa)

5.14

Isoelectric Point (pI)

62.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 272
AjiI CACGTC 2 cut(s) 30, 160
AjnI CCWGG 3 cut(s) 12, 129, 153
AluBI AGCT 3 cut(s) 179, 185, 230
AluI AGCT 3 cut(s) 179, 185, 230
Alw26I GTCTC 1 cut(s) 316
ApeKI GCWGC 1 cut(s) 203
AspS9I GGNCC 1 cut(s) 17
AvaII GGWCC 1 cut(s) 17
BbsI GAAGAC 1 cut(s) 297
BbvI GCAGC 1 cut(s) 215
BccI CCATC 1 cut(s) 116
BciT130I CCWGG 3 cut(s) 14, 131, 155
BciVI GTATCC 1 cut(s) 127
BcoDI GTCTC 1 cut(s) 316
BfaI CTAG 2 cut(s) 150, 362
BfuI GTATCC 1 cut(s) 127
BglI GCCNNNNNGGC 1 cut(s) 212
BisI GCNGC 1 cut(s) 204
BlsI GCNGC 1 cut(s) 205
Bme1390I CCNGG 3 cut(s) 14, 131, 155
Bme18I GGWCC 1 cut(s) 17
BmgBI CACGTC 2 cut(s) 30, 160
BmgT120I GGNCC 1 cut(s) 17
BmiI GGNNCC 2 cut(s) 18, 19
BmrFI CCNGG 3 cut(s) 14, 131, 155
BmsI GCATC 1 cut(s) 118
BpiI GAAGAC 1 cut(s) 297
BpmI CTGGAG 1 cut(s) 251
BpuEI CTTGAG 3 cut(s) 98, 128, 165
BsaI GGTCTC 1 cut(s) 316
BsaJI CCNNGG 2 cut(s) 12, 13
BsaWI WCCGGW 2 cut(s) 72, 84
Bse1I ACTGG 2 cut(s) 59, 268
Bse3DI GCAATG 1 cut(s) 340
BseBI CCWGG 3 cut(s) 14, 131, 155
BseDI CCNNGG 2 cut(s) 12, 13
BseGI GGATG 2 cut(s) 234, 262
BseMI GCAATG 1 cut(s) 340
BseNI ACTGG 2 cut(s) 59, 268
BseXI GCAGC 1 cut(s) 215
BsiSI CCGG 2 cut(s) 73, 85
BslFI GGGAC 1 cut(s) 30
BsmAI GTCTC 1 cut(s) 316
BsmFI GGGAC 1 cut(s) 30
Bso31I GGTCTC 1 cut(s) 316
BspLI GGNNCC 2 cut(s) 18, 19
BspTNI GGTCTC 1 cut(s) 316
BsrDI GCAATG 1 cut(s) 340
BsrI ACTGG 2 cut(s) 59, 268
BssECI CCNNGG 2 cut(s) 12, 13
Bst2UI CCWGG 3 cut(s) 14, 131, 155
BstC8I GCNNGC 2 cut(s) 107, 177
BstDEI CTNAG 1 cut(s) 208
BstF5I GGATG 2 cut(s) 234, 262
BstMAI GTCTC 1 cut(s) 316
BstMWI GCNNNNNNNGC 5 cut(s) 32, 191, 200, 212, 221
BstNI CCWGG 3 cut(s) 14, 131, 155
BstSCI CCNGG 3 cut(s) 12, 129, 153
BstV1I GCAGC 1 cut(s) 215
BstV2I GAAGAC 1 cut(s) 297
BsuI GTATCC 1 cut(s) 127
BtrI CACGTC 2 cut(s) 30, 160
BtsCI GGATG 2 cut(s) 234, 262
BtsI GCAGTG 1 cut(s) 21
BtsIMutI CAGTG 1 cut(s) 21
Cac8I GCNNGC 2 cut(s) 107, 177
Cfr13I GGNCC 1 cut(s) 17
Csp6I GTAC 1 cut(s) 271
CviJI RGCY 6 cut(s) 148, 153, 179, 185, 206, 230
CviKI_1 RGCY 6 cut(s) 148, 153, 179, 185, 206, 230
CviQI GTAC 1 cut(s) 271
DdeI CTNAG 1 cut(s) 208
Eco31I GGTCTC 1 cut(s) 316
Eco47I GGWCC 1 cut(s) 17
EcoO109I RGGNCCY 1 cut(s) 17
EcoRII CCWGG 3 cut(s) 12, 129, 153
FaiI YATR 4 cut(s) 252, 254, 281, 307
FaqI GGGAC 1 cut(s) 30
FauNDI CATATG 1 cut(s) 252
Fnu4HI GCNGC 1 cut(s) 204
FokI GGATG 2 cut(s) 221, 269
Fsp4HI GCNGC 1 cut(s) 204
FspBI CTAG 2 cut(s) 150, 362
GluI GCNGC 1 cut(s) 204
GsuI CTGGAG 1 cut(s) 251
HapII CCGG 2 cut(s) 73, 85
HincII GTYRAC 4 cut(s) 6, 54, 64, 78
HindII GTYRAC 4 cut(s) 6, 54, 64, 78
HindIII AAGCTT 1 cut(s) 183
HinfI GANTC 4 cut(s) 126, 139, 260, 344
HpaII CCGG 2 cut(s) 73, 85
Hpy166II GTNNAC 4 cut(s) 6, 54, 64, 78
Hpy188III TCNNGA 2 cut(s) 95, 356
Hpy8I GTNNAC 4 cut(s) 6, 54, 64, 78
HpyCH4IV ACGT 2 cut(s) 29, 159
HpyF10VI GCNNNNNNNGC 5 cut(s) 32, 191, 200, 212, 221
HpyF3I CTNAG 1 cut(s) 208
HpySE526I ACGT 2 cut(s) 29, 159
KflI GGGWCCC 1 cut(s) 17
LmnI GCTCC 1 cut(s) 270
Lsp1109I GCAGC 1 cut(s) 215
LweI GCATC 1 cut(s) 118
MaeI CTAG 2 cut(s) 150, 362
MaeII ACGT 2 cut(s) 29, 159
MaeIII GTNAC 1 cut(s) 341
MboII GAAGA 2 cut(s) 302, 332
MluCI AATT 2 cut(s) 68, 366
MlyI GAGTC 1 cut(s) 338
MnlI CCTC 1 cut(s) 205
MslI CAYNNNNRTG 2 cut(s) 239, 255
MspI CCGG 2 cut(s) 73, 85
MspR9I CCNGG 3 cut(s) 14, 131, 155
MvaI CCWGG 3 cut(s) 14, 131, 155
MwoI GCNNNNNNNGC 5 cut(s) 32, 191, 200, 212, 221
NdeI CATATG 1 cut(s) 252
NlaIV GGNNCC 2 cut(s) 18, 19
NmuCI GTSAC 1 cut(s) 341
PasI CCCWGGG 1 cut(s) 13
PfeI GAWTC 3 cut(s) 126, 139, 260
PfoI TCCNGGA 1 cut(s) 129
PkrI GCNGC 1 cut(s) 205
PleI GAGTC 1 cut(s) 338
PpsI GAGTC 1 cut(s) 338
PpuMI RGGWCCY 1 cut(s) 17
Psp5II RGGWCCY 1 cut(s) 17
Psp6I CCWGG 3 cut(s) 12, 129, 153
PspGI CCWGG 3 cut(s) 12, 129, 153
PspN4I GGNNCC 2 cut(s) 18, 19
PspPI GGNCC 1 cut(s) 17
PspPPI RGGWCCY 1 cut(s) 17
RsaI GTAC 1 cut(s) 272
RsaNI GTAC 1 cut(s) 271
RseI CAYNNNNRTG 2 cut(s) 239, 255
SatI GCNGC 1 cut(s) 204
Sau96I GGNCC 1 cut(s) 17
SchI GAGTC 1 cut(s) 338
ScrFI CCNGG 3 cut(s) 14, 131, 155
SetI ASST 9 cut(s) 32, 53, 120, 162, 181, 187, 232, 305, 363
SfaNI GCATC 1 cut(s) 118
SinI GGWCC 1 cut(s) 17
SmiMI CAYNNNNRTG 2 cut(s) 239, 255
SmlI CTYRAG 3 cut(s) 113, 143, 180
SmoI CTYRAG 3 cut(s) 113, 143, 180
Sse9I AATT 2 cut(s) 68, 366
SspMI CTAG 2 cut(s) 150, 362
StyD4I CCNGG 3 cut(s) 12, 129, 153
TaiI ACGT 2 cut(s) 32, 162
TaqI TCGA 2 cut(s) 120, 318
TasI AATT 2 cut(s) 68, 366
TfiI GAWTC 3 cut(s) 126, 139, 260
TscAI CASTG 1 cut(s) 28
TseFI GTSAC 1 cut(s) 341
TseI GCWGC 1 cut(s) 203
Tsp45I GTSAC 1 cut(s) 341
TspDTI ATGAA 1 cut(s) 296
TspGWI ACGGA 1 cut(s) 329
TspRI CASTG 1 cut(s) 28
VpaK11BI GGWCC 1 cut(s) 17
XcmI CCANNNNNNNNNTGG 1 cut(s) 34
XspI CTAG 2 cut(s) 150, 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.