Rmu_sc0002955.1_g000006

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002955.1
N/A
Physical Location & Seq
Forward (+)
57263 .. 57617
355 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002955.1_g000006.1.cds

Sequence Viewer

Length: 264 bp
atgactaccgccaggggaacgatggggtacattgcacctgaagtgttctccaggaactttggaaatgtgtcctataagtcagatgtctatagctatggaatgatactgcttgagattgtaagaaggagaaagaacattggttcaaccacagagaacaccaatgaagtttactacccagaatatcgtccttctaagcaaggggtgattcagatgttggaagaaggagaaaacttaacgattcctccaaatccttttgcctcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.89

Weight (kDa)

6.22

Isoelectric Point (pI)

46.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 9
AcuI CTGAAG 1 cut(s) 60
AfaI GTAC 1 cut(s) 29
AgsI TTSAA 1 cut(s) 144
AjnI CCWGG 2 cut(s) 11, 50
AluBI AGCT 1 cut(s) 93
AluI AGCT 1 cut(s) 93
AsuHPI GGTGA 1 cut(s) 214
BccI CCATC 1 cut(s) 16
BciT130I CCWGG 2 cut(s) 13, 52
BfmI CTRYAG 1 cut(s) 88
Bme1390I CCNGG 2 cut(s) 13, 52
BmrFI CCNGG 2 cut(s) 13, 52
BpmI CTGGAG 1 cut(s) 34
BpuEI CTTGAG 1 cut(s) 131
BsaJI CCNNGG 1 cut(s) 12
BsaXI ACNNNNNCTCC 2 cut(s) 226, 256
Bse3DI GCAATG 1 cut(s) 30
BseBI CCWGG 2 cut(s) 13, 52
BseDI CCNNGG 1 cut(s) 12
BseMI GCAATG 1 cut(s) 30
BspACI CCGC 1 cut(s) 9
BsrDI GCAATG 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 12
Bst2UI CCWGG 2 cut(s) 13, 52
BstDEI CTNAG 2 cut(s) 192, 261
BstNI CCWGG 2 cut(s) 13, 52
BstSCI CCNGG 2 cut(s) 11, 50
BstSFI CTRYAG 1 cut(s) 88
Csp6I GTAC 1 cut(s) 28
CviJI RGCY 1 cut(s) 93
CviKI_1 RGCY 1 cut(s) 93
CviQI GTAC 1 cut(s) 28
DdeI CTNAG 2 cut(s) 192, 261
Eco57I CTGAAG 1 cut(s) 60
EcoRII CCWGG 2 cut(s) 11, 50
FaiI YATR 3 cut(s) 75, 90, 96
GsuI CTGGAG 1 cut(s) 34
HinfI GANTC 2 cut(s) 205, 238
HphI GGTGA 1 cut(s) 214
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 2 cut(s) 82, 210
Hpy8I GTNNAC 1 cut(s) 169
HpyAV CCTTC 3 cut(s) 117, 198, 215
HpyCH4V TGCA 1 cut(s) 35
HpyF3I CTNAG 2 cut(s) 192, 261
LpnPI CCDG 5 cut(s) 25, 37, 51, 64, 189
MboII GAAGA 1 cut(s) 230
MmeI TCCRAC 1 cut(s) 195
MnlI CCTC 1 cut(s) 252
MseI TTAA 1 cut(s) 233
MspR9I CCNGG 2 cut(s) 13, 52
MvaI CCWGG 2 cut(s) 13, 52
PfeI GAWTC 2 cut(s) 205, 238
PfoI TCCNGGA 1 cut(s) 50
Psp6I CCWGG 2 cut(s) 11, 50
PspGI CCWGG 2 cut(s) 11, 50
RsaI GTAC 1 cut(s) 29
RsaNI GTAC 1 cut(s) 28
SaqAI TTAA 1 cut(s) 233
ScrFI CCNGG 2 cut(s) 13, 52
SetI ASST 2 cut(s) 40, 95
SfcI CTRYAG 1 cut(s) 88
SgeI CNNG 8 cut(s) 24, 25, 50, 63, 64, 122, 188, 209
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
SsiI CCGC 1 cut(s) 9
StyD4I CCNGG 2 cut(s) 11, 50
TfiI GAWTC 2 cut(s) 205, 238
Tru1I TTAA 1 cut(s) 233
Tru9I TTAA 1 cut(s) 233
TspDTI ATGAA 1 cut(s) 177
XcmI CCANNNNNNNNNTGG 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.