Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002973.1

Orthogroup ID

OG0025549

Physical Location & Seq

Genomic Coordinates Forward (+)

55964 .. 57000

Gene Structure 1037 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 903 bp

atggcaccatctatgcactatgggtacacacaacaacacgggtactcacagaacaatgtcacccagtcaatattggctccacagcaaggaaacctctcacaaagtaatacaaggaatttcacatcccagcaagcatgtagtaatgaactaatgacaatgtatactctgatggtggatatatgcaagttccctatagtggtagaatatcacagccctaccatggtccacaacatgatttctcacagaaatttggggacccttctaggaagttcaatgaaagaagctataataatatttcagagaacaacaacagcagttgttatcctcaaacttccaatcgacagggttctcaactacaacaacaaaaacaatggcaaagtggagacttttttactgcagcaaaatggtggtgtcttttcacagcagcaaaatggtggttttcagcaaaataacaaattgcaacatcttgatgccctcacacaggagagagaaaatattgacttgaatatgggtgctgcagagaatatgggaaaacatgtcactgcggcggaaacaaataagaaggctggaaccaaaggggctgaaaatagtttggacaagatcatgcttaaacctatgcacagggtggagaaagagaagatgaagatgaaatttggtgccttcacaaaacttggtgttgtgcctcctgcaaccaacattactcattctcaacacgatggttccggctctactgtagaatgtcaagcccaggttgcctttcccacttttaaaccaatgctagtctccattgataccccaacatggcaacaagctattctcagagaaatcaacactgtgttgatagaaggctcttcacagctacacttcactcctccagatagaccattaatgaattgtaggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

300

Amino Acids

33.46

Weight (kDa)

8.98

Isoelectric Point (pI)

43.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025549)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0002973.1_g000005 Rmu_sc0003180.1_g000002
rosa_roxburghii	Rroxscaffold_6G00430750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	4, 656
AccI	GTMKAC	1 cut(s)	161
AciI	CCGC	2 cut(s)	545, 548
AcsI	RAATTY	3 cut(s)	115, 247, 650
AdeI	CACNNNGTG	1 cut(s)	625
AfaI	GTAC	2 cut(s)	26, 44
AfiI	CCNNNNNNNGG	5 cut(s)	86, 196, 220, 481, 801
AflIII	ACRYGT	1 cut(s)	535
AgsI	TTSAA	2 cut(s)	273, 505
AjnI	CCWGG	1 cut(s)	747
AluBI	AGCT	3 cut(s)	284, 812, 859
AluI	AGCT	3 cut(s)	284, 812, 859
Alw26I	GTCTC	2 cut(s)	377, 787
ApeKI	GCWGC	3 cut(s)	397, 424, 515
ApoI	RAATTY	3 cut(s)	115, 247, 650
AseI	ATTAAT	1 cut(s)	887
AspS9I	GGNCC	2 cut(s)	223, 255
AsuHPI	GGTGA	1 cut(s)	52
AvaII	GGWCC	2 cut(s)	223, 255
BanI	GGYRCC	2 cut(s)	4, 656
BbvI	GCAGC	3 cut(s)	409, 436, 502
BccI	CCATC	3 cut(s)	16, 163, 710
BciT130I	CCWGG	1 cut(s)	749
BcoDI	GTCTC	2 cut(s)	377, 787
BfaI	CTAG	2 cut(s)	263, 779
BfmI	CTRYAG	4 cut(s)	192, 395, 516, 732
BisI	GCNGC	4 cut(s)	398, 425, 516, 546
BlsI	GCNGC	4 cut(s)	399, 426, 517, 547
Bme1390I	CCNGG	1 cut(s)	749
Bme18I	GGWCC	2 cut(s)	223, 255
BmgT120I	GGNCC	2 cut(s)	223, 255
BmiI	GGNNCC	7 cut(s)	6, 78, 256, 257, 571, 658, 721
BmrFI	CCNGG	1 cut(s)	749
BmrI	ACTGGG	1 cut(s)	58
BmsI	GCATC	1 cut(s)	460
BmuI	ACTGGG	1 cut(s)	58
BpmI	CTGGAG	1 cut(s)	858
BsaJI	CCNNGG	2 cut(s)	219, 747
Bsc4I	CCNNNNNNNGG	5 cut(s)	86, 196, 220, 481, 801
Bse1I	ACTGG	1 cut(s)	64
BseBI	CCWGG	1 cut(s)	749
BseDI	CCNNGG	2 cut(s)	219, 747
BseGI	GGATG	1 cut(s)	122
BseLI	CCNNNNNNNGG	5 cut(s)	86, 196, 220, 481, 801
BseMII	CTCAG	1 cut(s)	832
BseNI	ACTGG	1 cut(s)	64
BseRI	GAGGAG	1 cut(s)	861
BseXI	GCAGC	3 cut(s)	409, 436, 502
BseYI	CCCAGC	1 cut(s)	126
BshNI	GGYRCC	2 cut(s)	4, 656
BsiSI	CCGG	1 cut(s)	723
BslFI	GGGAC	1 cut(s)	268
BslI	CCNNNNNNNGG	5 cut(s)	86, 196, 220, 481, 801
BsmAI	GTCTC	2 cut(s)	377, 787
BsmFI	GGGAC	1 cut(s)	268
Bsp143I	GATC	1 cut(s)	600
Bsp19I	CCATGG	1 cut(s)	219
BspACI	CCGC	2 cut(s)	545, 548
BspCNI	CTCAG	1 cut(s)	831
BspLI	GGNNCC	7 cut(s)	6, 78, 256, 257, 571, 658, 721
BspMAI	CTGCAG	2 cut(s)	399, 520
BspQI	GCTCTTC	1 cut(s)	856
BspT107I	GGYRCC	2 cut(s)	4, 656
BsrI	ACTGG	1 cut(s)	64
BssECI	CCNNGG	2 cut(s)	219, 747
BssMI	GATC	1 cut(s)	600
BssNAI	GTATAC	1 cut(s)	162
BssT1I	CCWWGG	1 cut(s)	219
Bst1107I	GTATAC	1 cut(s)	162
Bst2UI	CCWGG	1 cut(s)	749
Bst4CI	ACNGT	2 cut(s)	733, 835
Bst6I	CTCTTC	1 cut(s)	856
BstC8I	GCNNGC	1 cut(s)	132
BstDEI	CTNAG	1 cut(s)	818
BstDSI	CCRYGG	1 cut(s)	219
BstENI	CCTNNNNNAGG	1 cut(s)	479
BstF5I	GGATG	1 cut(s)	122
BstKTI	GATC	1 cut(s)	603
BstMAI	GTCTC	2 cut(s)	377, 787
BstMBI	GATC	1 cut(s)	600
BstMWI	GCNNNNNNNGC	1 cut(s)	752
BstNI	CCWGG	1 cut(s)	749
BstNSI	RCATGY	2 cut(s)	138, 539
BstSCI	CCNGG	1 cut(s)	747
BstSFI	CTRYAG	4 cut(s)	192, 395, 516, 732
BstV1I	GCAGC	3 cut(s)	409, 436, 502
BstZ17I	GTATAC	1 cut(s)	162
BtgI	CCRYGG	1 cut(s)	219
BtsCI	GGATG	1 cut(s)	122
BtsI	GCAGTG	1 cut(s)	540
BtsIMutI	CAGTG	2 cut(s)	540, 831
Cac8I	GCNNGC	1 cut(s)	132
Cfr13I	GGNCC	2 cut(s)	223, 255
Csp6I	GTAC	2 cut(s)	25, 43
CviAII	CATG	6 cut(s)	135, 220, 232, 536, 604, 801
CviQI	GTAC	2 cut(s)	25, 43
DdeI	CTNAG	1 cut(s)	818
DpnI	GATC	1 cut(s)	602
DpnII	GATC	1 cut(s)	600
DraI	TTTAAA	1 cut(s)	769
DraIII	CACNNNGTG	1 cut(s)	625
Eam1104I	CTCTTC	1 cut(s)	856
EarI	CTCTTC	1 cut(s)	856
EciI	GGCGGA	1 cut(s)	563
Eco130I	CCWWGG	1 cut(s)	219
Eco47I	GGWCC	2 cut(s)	223, 255
EcoNI	CCTNNNNNAGG	1 cut(s)	479
EcoO109I	RGGNCCY	1 cut(s)	255
EcoRII	CCWGG	1 cut(s)	747
EcoT14I	CCWWGG	1 cut(s)	219
ErhI	CCWWGG	1 cut(s)	219
FaeI	CATG	6 cut(s)	138, 223, 235, 539, 607, 804
FaqI	GGGAC	1 cut(s)	268
FatI	CATG	6 cut(s)	134, 219, 231, 535, 603, 800
FblI	GTMKAC	1 cut(s)	161
Fnu4HI	GCNGC	4 cut(s)	398, 425, 516, 546
FokI	GGATG	1 cut(s)	109
Fsp4HI	GCNGC	4 cut(s)	398, 425, 516, 546
FspBI	CTAG	2 cut(s)	263, 779
GluI	GCNGC	4 cut(s)	398, 425, 516, 546
GsaI	CCCAGC	1 cut(s)	130
GsuI	CTGGAG	1 cut(s)	858
HapII	CCGG	1 cut(s)	723
Hin1II	CATG	6 cut(s)	138, 223, 235, 539, 607, 804
HpaII	CCGG	1 cut(s)	723
HphI	GGTGA	1 cut(s)	52
Hpy166II	GTNNAC	3 cut(s)	27, 162, 226
Hpy188I	TCNGA	3 cut(s)	168, 300, 821
Hpy188III	TCNNGA	2 cut(s)	467, 875
Hpy8I	GTNNAC	3 cut(s)	27, 162, 226
HpyAV	CCTTC	4 cut(s)	269, 556, 670, 839
HpyCH4III	ACNGT	2 cut(s)	733, 835
HpyCH4V	TGCA	7 cut(s)	16, 183, 397, 460, 518, 619, 689
HpyF10VI	GCNNNNNNNGC	1 cut(s)	752
HpyF3I	CTNAG	1 cut(s)	818
Hsp92II	CATG	6 cut(s)	138, 223, 235, 539, 607, 804
KflI	GGGWCCC	1 cut(s)	255
Kzo9I	GATC	1 cut(s)	600
LguI	GCTCTTC	1 cut(s)	856
LmnI	GCTCC	1 cut(s)	82
Lsp1109I	GCAGC	3 cut(s)	409, 436, 502
LweI	GCATC	1 cut(s)	460
MaeI	CTAG	2 cut(s)	263, 779
MaeIII	GTNAC	2 cut(s)	58, 538
MalI	GATC	1 cut(s)	602
MboI	GATC	1 cut(s)	600
MboII	GAAGA	3 cut(s)	649, 655, 843
MluCI	AATT	5 cut(s)	115, 247, 455, 650, 892
MnlI	CCTC	5 cut(s)	104, 335, 485, 693, 882
MseI	TTAA	3 cut(s)	609, 768, 887
MslI	CAYNNNNRTG	1 cut(s)	468
MspI	CCGG	1 cut(s)	723
MspR9I	CCNGG	1 cut(s)	749
MvaI	CCWGG	1 cut(s)	749
MwoI	GCNNNNNNNGC	1 cut(s)	752
NcoI	CCATGG	1 cut(s)	219
NdeII	GATC	1 cut(s)	600
NlaIII	CATG	6 cut(s)	138, 223, 235, 539, 607, 804
NlaIV	GGNNCC	7 cut(s)	6, 78, 256, 257, 571, 658, 721
NmuCI	GTSAC	2 cut(s)	58, 538
NspI	RCATGY	2 cut(s)	138, 539
PciI	ACATGT	1 cut(s)	535
PciSI	GCTCTTC	1 cut(s)	856
PkrI	GCNGC	4 cut(s)	399, 426, 517, 547
PpuMI	RGGWCCY	1 cut(s)	255
PscI	ACATGT	1 cut(s)	535
PshBI	ATTAAT	1 cut(s)	887
Psp5II	RGGWCCY	1 cut(s)	255
Psp6I	CCWGG	1 cut(s)	747
PspFI	CCCAGC	1 cut(s)	126
PspGI	CCWGG	1 cut(s)	747
PspN4I	GGNNCC	7 cut(s)	6, 78, 256, 257, 571, 658, 721
PspPI	GGNCC	2 cut(s)	223, 255
PspPPI	RGGWCCY	1 cut(s)	255
PstI	CTGCAG	2 cut(s)	399, 520
RsaI	GTAC	2 cut(s)	26, 44
RsaNI	GTAC	2 cut(s)	25, 43
RseI	CAYNNNNRTG	1 cut(s)	468
SapI	GCTCTTC	1 cut(s)	856
SaqAI	TTAA	3 cut(s)	609, 768, 887
SatI	GCNGC	4 cut(s)	398, 425, 516, 546
Sau3AI	GATC	1 cut(s)	600
Sau96I	GGNCC	2 cut(s)	223, 255
ScrFI	CCNGG	1 cut(s)	749
SetI	ASST	7 cut(s)	96, 286, 616, 753, 814, 861, 902
SfaNI	GCATC	1 cut(s)	460
SfcI	CTRYAG	4 cut(s)	192, 395, 516, 732
SinI	GGWCC	2 cut(s)	223, 255
SmiMI	CAYNNNNRTG	1 cut(s)	468
Sse9I	AATT	5 cut(s)	115, 247, 455, 650, 892
SsiI	CCGC	2 cut(s)	545, 548
SspI	AATATT	3 cut(s)	72, 294, 496
SspMI	CTAG	2 cut(s)	263, 779
StyD4I	CCNGG	1 cut(s)	747
StyI	CCWWGG	1 cut(s)	219
TaaI	ACNGT	2 cut(s)	733, 835
TaqI	TCGA	1 cut(s)	339
TasI	AATT	5 cut(s)	115, 247, 455, 650, 892
TauI	GCSGC	1 cut(s)	548
Tru1I	TTAA	3 cut(s)	609, 768, 887
Tru9I	TTAA	3 cut(s)	609, 768, 887
TscAI	CASTG	2 cut(s)	547, 838
TseFI	GTSAC	2 cut(s)	58, 538
TseI	GCWGC	3 cut(s)	397, 424, 515
Tsp45I	GTSAC	2 cut(s)	58, 538
TspDTI	ATGAA	4 cut(s)	159, 290, 656, 662
TspRI	CASTG	2 cut(s)	547, 838
VpaK11BI	GGWCC	2 cut(s)	223, 255
VspI	ATTAAT	1 cut(s)	887
XagI	CCTNNNNNAGG	1 cut(s)	479
XapI	RAATTY	3 cut(s)	115, 247, 650
XceI	RCATGY	2 cut(s)	138, 539
XmiI	GTMKAC	1 cut(s)	161
XspI	CTAG	2 cut(s)	263, 779

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.