Rmu_sc0003031.1_g000058

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003031.1
N/A
Physical Location & Seq
Reverse (-)
215421 .. 215789
369 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 369 bp
atgtttctaaggcgacatattgatcctagtctacgctgggagtactttaagttaaagacacccaaagaacagtgggatgcccttaagggacgttttgggaacattcatgacactttgctcccagaactggccgttcagtggaatgaaatccacttgcttaactacaaaagggtcaatgacttcaacaaggacatgttgcgcctcaaggcacgtctcaatttatgtggaaaggaactcacagaagattatatgatccagaagactcaattcatttttcctacttcagcacttatactagtgaaccaatataggctagagtatgacaacaaaagaatcacaaccttcaataagctgatcaacctactgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

122

Amino Acids

14.83

Weight (kDa)

9.55

Isoelectric Point (pI)

55.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 31
AclWI GGATC 2 cut(s) 17, 247
AcoI YGGCCR 1 cut(s) 129
AcuI CTGAAG 1 cut(s) 267
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 2 cut(s) 127, 138
AflII CTTAAG 1 cut(s) 83
AflIII ACRYGT 1 cut(s) 192
AgsI TTSAA 2 cut(s) 184, 346
AhlI ACTAGT 1 cut(s) 295
AjiI CACGTC 1 cut(s) 212
AluBI AGCT 1 cut(s) 352
AluI AGCT 1 cut(s) 352
Alw26I GTCTC 1 cut(s) 218
AlwI GGATC 2 cut(s) 17, 247
AoxI GGCC 1 cut(s) 129
AspLEI GCGC 1 cut(s) 201
BbsI GAAGAC 1 cut(s) 266
BceAI ACGGC 1 cut(s) 116
BclI TGATCA 1 cut(s) 354
BcoDI GTCTC 1 cut(s) 218
BcuI ACTAGT 1 cut(s) 295
BfaI CTAG 3 cut(s) 27, 296, 314
BfrI CTTAAG 1 cut(s) 83
BmcAI AGTACT 1 cut(s) 44
BmgBI CACGTC 1 cut(s) 212
BmsI GCATC 1 cut(s) 67
BpiI GAAGAC 1 cut(s) 266
BpuEI CTTGAG 1 cut(s) 188
Bsc4I CCNNNNNNNGG 2 cut(s) 127, 138
Bse1I ACTGG 1 cut(s) 132
BseGI GGATG 1 cut(s) 82
BseLI CCNNNNNNNGG 2 cut(s) 127, 138
BseNI ACTGG 1 cut(s) 132
BseYI CCCAGC 1 cut(s) 36
BshFI GGCC 1 cut(s) 131
BslFI GGGAC 1 cut(s) 102
BslI CCNNNNNNNGG 2 cut(s) 127, 138
BsmAI GTCTC 1 cut(s) 218
BsmBI CGTCTC 1 cut(s) 218
BsmFI GGGAC 1 cut(s) 102
BsnI GGCC 1 cut(s) 131
Bsp143I GATC 3 cut(s) 22, 252, 354
BspANI GGCC 1 cut(s) 131
BspHI TCATGA 1 cut(s) 106
BspPI GGATC 2 cut(s) 17, 247
BspTI CTTAAG 1 cut(s) 83
BsrI ACTGG 1 cut(s) 132
BssMI GATC 3 cut(s) 22, 252, 354
Bst4CI ACNGT 2 cut(s) 72, 366
BstAFI CTTAAG 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 8
BstF5I GGATG 1 cut(s) 82
BstHHI GCGC 1 cut(s) 201
BstKTI GATC 3 cut(s) 25, 255, 357
BstMAI GTCTC 1 cut(s) 218
BstMBI GATC 3 cut(s) 22, 252, 354
BstNSI RCATGY 1 cut(s) 196
BstV2I GAAGAC 1 cut(s) 266
BsuRI GGCC 1 cut(s) 131
BtrI CACGTC 1 cut(s) 212
BtsCI GGATG 1 cut(s) 82
BtsIMutI CAGTG 2 cut(s) 77, 143
CciI TCATGA 1 cut(s) 106
CfoI GCGC 1 cut(s) 201
Csp6I GTAC 1 cut(s) 43
CspCI CAANNNNNGTGG 2 cut(s) 205, 240
CviAII CATG 2 cut(s) 107, 193
CviJI RGCY 3 cut(s) 131, 313, 352
CviKI_1 RGCY 3 cut(s) 131, 313, 352
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 1 cut(s) 8
DpnI GATC 3 cut(s) 24, 254, 356
DpnII GATC 3 cut(s) 22, 252, 354
EaeI YGGCCR 1 cut(s) 129
Eco57I CTGAAG 1 cut(s) 267
Esp3I CGTCTC 1 cut(s) 218
FaeI CATG 2 cut(s) 110, 196
FaiI YATR 9 cut(s) 18, 108, 194, 223, 249, 251, 293, 309, 321
FaqI GGGAC 1 cut(s) 102
FatI CATG 2 cut(s) 106, 192
FbaI TGATCA 1 cut(s) 354
FblI GTMKAC 1 cut(s) 31
FokI GGATG 1 cut(s) 89
FspBI CTAG 3 cut(s) 27, 296, 314
GlaI GCGC 1 cut(s) 200
GsaI CCCAGC 1 cut(s) 40
HaeIII GGCC 1 cut(s) 131
HhaI GCGC 1 cut(s) 201
Hin1II CATG 2 cut(s) 110, 196
Hin6I GCGC 1 cut(s) 199
HinP1I GCGC 1 cut(s) 199
HinfI GANTC 2 cut(s) 262, 333
Hpy166II GTNNAC 2 cut(s) 32, 301
Hpy188III TCNNGA 2 cut(s) 107, 256
Hpy8I GTNNAC 2 cut(s) 32, 301
HpyAV CCTTC 1 cut(s) 352
HpyCH4III ACNGT 2 cut(s) 72, 366
HpyCH4IV ACGT 2 cut(s) 91, 211
HpyF3I CTNAG 1 cut(s) 8
HpySE526I ACGT 2 cut(s) 91, 211
Hsp92II CATG 2 cut(s) 110, 196
HspAI GCGC 1 cut(s) 199
Ksp22I TGATCA 1 cut(s) 354
Kzo9I GATC 3 cut(s) 22, 252, 354
LmnI GCTCC 1 cut(s) 123
LpnPI CCDG 4 cut(s) 22, 113, 135, 269
LweI GCATC 1 cut(s) 67
MaeI CTAG 3 cut(s) 27, 296, 314
MaeII ACGT 2 cut(s) 91, 211
MalI GATC 3 cut(s) 24, 254, 356
MboI GATC 3 cut(s) 22, 252, 354
MboII GAAGA 2 cut(s) 254, 271
MluCI AATT 2 cut(s) 217, 266
MlyI GAGTC 1 cut(s) 256
MnlI CCTC 1 cut(s) 212
MseI TTAA 4 cut(s) 48, 53, 84, 159
MspCI CTTAAG 1 cut(s) 83
NdeII GATC 3 cut(s) 22, 252, 354
NlaIII CATG 2 cut(s) 110, 196
NspI RCATGY 1 cut(s) 196
PagI TCATGA 1 cut(s) 106
PciI ACATGT 1 cut(s) 192
PfeI GAWTC 1 cut(s) 333
PleI GAGTC 1 cut(s) 256
PpsI GAGTC 1 cut(s) 256
PscI ACATGT 1 cut(s) 192
PspFI CCCAGC 1 cut(s) 36
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 4 cut(s) 48, 53, 84, 159
Sau3AI GATC 3 cut(s) 22, 252, 354
ScaI AGTACT 1 cut(s) 44
SchI GAGTC 1 cut(s) 256
SetI ASST 5 cut(s) 94, 214, 344, 354, 363
SfaNI GCATC 1 cut(s) 67
SmlI CTYRAG 2 cut(s) 83, 203
SmoI CTYRAG 2 cut(s) 83, 203
SpeI ACTAGT 1 cut(s) 295
Sse9I AATT 2 cut(s) 217, 266
SspMI CTAG 3 cut(s) 27, 296, 314
TaaI ACNGT 2 cut(s) 72, 366
TaiI ACGT 2 cut(s) 94, 214
TasI AATT 2 cut(s) 217, 266
TatI WGTACW 1 cut(s) 42
TfiI GAWTC 1 cut(s) 333
Tru1I TTAA 4 cut(s) 48, 53, 84, 159
Tru9I TTAA 4 cut(s) 48, 53, 84, 159
TscAI CASTG 2 cut(s) 77, 143
TspDTI ATGAA 3 cut(s) 95, 159, 259
TspRI CASTG 2 cut(s) 77, 143
Vha464I CTTAAG 1 cut(s) 83
XceI RCATGY 1 cut(s) 196
XmiI GTMKAC 1 cut(s) 31
XspI CTAG 3 cut(s) 27, 296, 314
ZrmI AGTACT 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.