Rmu_sc0003063.1_g000008

disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003063.1
N/A
Physical Location & Seq
Forward (+)
21584 .. 22192
609 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003063.1_g000008.1.cds

Sequence Viewer

Length: 609 bp
atgcctgccgctatagttaatgttgaacaacctaatccacggcctaaaacttcatctttcgttgatatatcgaccatatatggacgagaagttgaaaaagagtggctggtgagtgagttgttaagggggaggcacggcctagtcatccccattgtagggacgggaggattggggaaaacaactcttacccaaatagtcttgaaggatccacgagttcaagcccattttgataccaaaccatgggtttgtgtctcagacccttttgatgtcatcaaaattgcaaaagaaatccttcaaattgtcagtagaaaatctcaaaatagttcaaatgtcttgcaaatgttattaggagacattgaggagcatatcaaggacaaaaagattcttcttgtcctagatgatgtgtggactgagaaccgaacagagtgggagaggttgagtttaccactactaatgcaaagctgttctgaaggcagtagaattctggtgaccactcgaaagcaggaggttgctcaaatgatgagagcaaccagtgacatgatcactatggggaagttgagtcattcagattctttgaaactattcaatagtattgcactagcaaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

202

Amino Acids

22.69

Weight (kDa)

7.79

Isoelectric Point (pI)

32.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 240
AciI CCGC 1 cut(s) 9
AclWI GGATC 2 cut(s) 200, 213
AcsI RAATTY 1 cut(s) 480
AcuI CTGAAG 1 cut(s) 489
AfiI CCNNNNNNNGG 3 cut(s) 155, 156, 240
AgsI TTSAA 8 cut(s) 26, 95, 202, 218, 296, 327, 577, 586
AluBI AGCT 1 cut(s) 462
AluI AGCT 1 cut(s) 462
Alw26I GTCTC 2 cut(s) 256, 345
AlwI GGATC 2 cut(s) 200, 213
AoxI GGCC 2 cut(s) 41, 136
ApoI RAATTY 1 cut(s) 480
Asp700I GAANNNNTTC 2 cut(s) 291, 581
AsuHPI GGTGA 2 cut(s) 121, 499
BamHI GGATCC 1 cut(s) 205
BauI CACGAG 1 cut(s) 210
BceAI ACGGC 2 cut(s) 56, 151
BclI TGATCA 1 cut(s) 540
BcoDI GTCTC 2 cut(s) 256, 345
BfaI CTAG 3 cut(s) 140, 395, 599
BfmI CTRYAG 1 cut(s) 12
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
BmiI GGNNCC 1 cut(s) 207
BsaJI CCNNGG 2 cut(s) 38, 239
Bsc4I CCNNNNNNNGG 3 cut(s) 155, 156, 240
Bse1I ACTGG 1 cut(s) 531
BseDI CCNNGG 2 cut(s) 38, 239
BseGI GGATG 1 cut(s) 144
BseLI CCNNNNNNNGG 3 cut(s) 155, 156, 240
BseMII CTCAG 2 cut(s) 267, 402
BseNI ACTGG 1 cut(s) 531
BseRI GAGGAG 1 cut(s) 374
BshFI GGCC 2 cut(s) 43, 138
BslFI GGGAC 1 cut(s) 172
BslI CCNNNNNNNGG 3 cut(s) 155, 156, 240
BsmAI GTCTC 2 cut(s) 256, 345
BsmFI GGGAC 1 cut(s) 172
BsnI GGCC 2 cut(s) 43, 138
Bsp143I GATC 2 cut(s) 205, 540
Bsp19I CCATGG 1 cut(s) 239
BspACI CCGC 1 cut(s) 9
BspANI GGCC 2 cut(s) 43, 138
BspCNI CTCAG 2 cut(s) 266, 403
BspLI GGNNCC 1 cut(s) 207
BspPI GGATC 2 cut(s) 200, 213
BsrI ACTGG 1 cut(s) 531
BssECI CCNNGG 2 cut(s) 38, 239
BssMI GATC 2 cut(s) 205, 540
BssSI CACGAG 1 cut(s) 210
BssT1I CCWWGG 1 cut(s) 239
Bst2BI CACGAG 1 cut(s) 210
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 2 cut(s) 253, 411
BstDSI CCRYGG 2 cut(s) 38, 239
BstEII GGTNACC 1 cut(s) 487
BstF5I GGATG 1 cut(s) 144
BstKTI GATC 2 cut(s) 208, 543
BstMAI GTCTC 2 cut(s) 256, 345
BstMBI GATC 2 cut(s) 205, 540
BstPI GGTNACC 1 cut(s) 487
BstSFI CTRYAG 1 cut(s) 12
BstX2I RGATCY 1 cut(s) 205
BstYI RGATCY 1 cut(s) 205
BsuRI GGCC 2 cut(s) 43, 138
BtgI CCRYGG 2 cut(s) 38, 239
BtsCI GGATG 1 cut(s) 144
BtsIMutI CAGTG 1 cut(s) 538
Cac8I GCNNGC 1 cut(s) 6
CviAII CATG 2 cut(s) 240, 538
CviJI RGCY 5 cut(s) 43, 106, 138, 221, 462
CviKI_1 RGCY 5 cut(s) 43, 106, 138, 221, 462
DdeI CTNAG 2 cut(s) 253, 411
DpnI GATC 2 cut(s) 207, 542
DpnII GATC 2 cut(s) 205, 540
Eco130I CCWWGG 1 cut(s) 239
Eco57I CTGAAG 1 cut(s) 489
Eco91I GGTNACC 1 cut(s) 487
EcoO65I GGTNACC 1 cut(s) 487
EcoRI GAATTC 1 cut(s) 480
EcoT14I CCWWGG 1 cut(s) 239
ErhI CCWWGG 1 cut(s) 239
FaeI CATG 2 cut(s) 243, 541
FaiI YATR 9 cut(s) 14, 68, 77, 79, 81, 241, 366, 539, 548
FalI AAGNNNNNCTT 2 cut(s) 276, 308
FaqI GGGAC 1 cut(s) 172
FatI CATG 2 cut(s) 239, 537
FbaI TGATCA 1 cut(s) 540
Fnu4HI GCNGC 1 cut(s) 9
FokI GGATG 1 cut(s) 131
Fsp4HI GCNGC 1 cut(s) 9
FspBI CTAG 3 cut(s) 140, 395, 599
GluI GCNGC 1 cut(s) 9
HaeIII GGCC 2 cut(s) 43, 138
Hin1II CATG 2 cut(s) 243, 541
HinfI GANTC 3 cut(s) 382, 559, 569
HphI GGTGA 2 cut(s) 121, 499
Hpy166II GTNNAC 2 cut(s) 408, 443
Hpy188I TCNGA 3 cut(s) 256, 469, 568
Hpy188III TCNNGA 1 cut(s) 199
Hpy8I GTNNAC 2 cut(s) 408, 443
HpyAV CCTTC 3 cut(s) 196, 302, 464
HpyCH4V TGCA 4 cut(s) 281, 337, 457, 596
HpyF3I CTNAG 2 cut(s) 253, 411
Hsp92II CATG 2 cut(s) 243, 541
Ksp22I TGATCA 1 cut(s) 540
Kzo9I GATC 2 cut(s) 205, 540
LmnI GCTCC 1 cut(s) 361
LpnPI CCDG 5 cut(s) 18, 92, 470, 488, 544
MaeI CTAG 3 cut(s) 140, 395, 599
MaeIII GTNAC 2 cut(s) 487, 533
MalI GATC 2 cut(s) 207, 542
MboI GATC 2 cut(s) 205, 540
MboII GAAGA 1 cut(s) 377
MflI RGATCY 1 cut(s) 205
MluCI AATT 4 cut(s) 276, 297, 480, 604
MlyI GAGTC 1 cut(s) 568
MnlI CCTC 5 cut(s) 123, 158, 352, 426, 499
MroXI GAANNNNTTC 2 cut(s) 291, 581
MseI TTAA 2 cut(s) 18, 122
NcoI CCATGG 1 cut(s) 239
NdeII GATC 2 cut(s) 205, 540
NlaIII CATG 2 cut(s) 243, 541
NlaIV GGNNCC 1 cut(s) 207
NmuCI GTSAC 2 cut(s) 487, 533
PdmI GAANNNNTTC 2 cut(s) 291, 581
PfeI GAWTC 2 cut(s) 382, 569
PflMI CCANNNNNTGG 1 cut(s) 240
PkrI GCNGC 1 cut(s) 10
PleI GAGTC 1 cut(s) 567
PpsI GAGTC 1 cut(s) 567
PspEI GGTNACC 1 cut(s) 487
PspN4I GGNNCC 1 cut(s) 207
PsuI RGATCY 1 cut(s) 205
SaqAI TTAA 2 cut(s) 18, 122
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 2 cut(s) 205, 540
SchI GAGTC 1 cut(s) 568
SetI ASST 4 cut(s) 34, 437, 464, 510
SfcI CTRYAG 1 cut(s) 12
Sse9I AATT 4 cut(s) 276, 297, 480, 604
SsiI CCGC 1 cut(s) 9
SspMI CTAG 3 cut(s) 140, 395, 599
StyI CCWWGG 1 cut(s) 239
TaqI TCGA 2 cut(s) 71, 496
TasI AATT 4 cut(s) 276, 297, 480, 604
TauI GCSGC 1 cut(s) 11
TfiI GAWTC 2 cut(s) 382, 569
Tru1I TTAA 2 cut(s) 18, 122
Tru9I TTAA 2 cut(s) 18, 122
TscAI CASTG 1 cut(s) 538
TseFI GTSAC 2 cut(s) 487, 533
Tsp45I GTSAC 2 cut(s) 487, 533
TspDTI ATGAA 1 cut(s) 42
TspRI CASTG 1 cut(s) 538
Van91I CCANNNNNTGG 1 cut(s) 240
XapI RAATTY 1 cut(s) 480
XmnI GAANNNNTTC 2 cut(s) 291, 581
XspI CTAG 3 cut(s) 140, 395, 599
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.