Rmu_sc0003116.1_g000030

Leucine-rich repeats, outliers

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003116.1
N/A
Physical Location & Seq
Forward (+)
170835 .. 171212
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003116.1_g000030.1.cds

Sequence Viewer

Length: 378 bp
atgattgctcagttttccgactccgttgtgttcagattcttcagcacactcttcgtcgaagaagagatttctccgatgaggaattccggtttctctagcactgtaccggagagagctgaatctgagattcggaaaagttacgaagcagatgatgatgatgatgattcagaattctttgatgttggtgatatagagatctcagagccaaatttcgtgtttaaatttgagtaccagacttgggaaatattaaaaacaccggaaaaagcggatgtaataaaataccaacatggagacagcatgagggtgattcacaagttctacaatagttgcagaactcgaatgtgcaagttgggtattttgaattaccagaagttataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

14.74

Weight (kDa)

4.67

Isoelectric Point (pI)

46.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 376
AciI CCGC 1 cut(s) 266
AcsI RAATTY 4 cut(s) 82, 170, 208, 221
AcuI CTGAAG 1 cut(s) 25
AfaI GTAC 2 cut(s) 105, 230
AfiI CCNNNNNNNGG 1 cut(s) 238
AgsI TTSAA 1 cut(s) 361
AluBI AGCT 1 cut(s) 116
AluI AGCT 1 cut(s) 116
Alw26I GTCTC 1 cut(s) 285
ApoI RAATTY 4 cut(s) 82, 170, 208, 221
AsuHPI GGTGA 2 cut(s) 197, 316
BcgI CGANNNNNNTGC 2 cut(s) 34, 68
BcoDI GTCTC 1 cut(s) 285
BfaI CTAG 1 cut(s) 96
BglII AGATCT 1 cut(s) 195
BsaWI WCCGGW 3 cut(s) 86, 106, 256
Bsc4I CCNNNNNNNGG 1 cut(s) 238
BseGI GGATG 1 cut(s) 274
BseLI CCNNNNNNNGG 1 cut(s) 238
BseMII CTCAG 3 cut(s) 23, 114, 213
BsiSI CCGG 3 cut(s) 87, 107, 257
BslI CCNNNNNNNGG 1 cut(s) 238
BsmAI GTCTC 1 cut(s) 285
Bsp143I GATC 1 cut(s) 195
BspACI CCGC 1 cut(s) 266
BspCNI CTCAG 3 cut(s) 22, 115, 212
BssMI GATC 1 cut(s) 195
Bst4CI ACNGT 1 cut(s) 103
Bst6I CTCTTC 2 cut(s) 56, 57
BstDEI CTNAG 3 cut(s) 9, 123, 199
BstF5I GGATG 1 cut(s) 274
BstKTI GATC 1 cut(s) 198
BstMAI GTCTC 1 cut(s) 285
BstMBI GATC 1 cut(s) 195
BstX2I RGATCY 1 cut(s) 195
BstYI RGATCY 1 cut(s) 195
BtsCI GGATG 1 cut(s) 274
BtsIMutI CAGTG 1 cut(s) 99
Csp6I GTAC 2 cut(s) 104, 229
CviAII CATG 2 cut(s) 287, 298
CviJI RGCY 2 cut(s) 116, 205
CviKI_1 RGCY 2 cut(s) 116, 205
CviQI GTAC 2 cut(s) 104, 229
DdeI CTNAG 3 cut(s) 9, 123, 199
DpnI GATC 1 cut(s) 197
DpnII GATC 1 cut(s) 195
DraI TTTAAA 1 cut(s) 220
Eam1104I CTCTTC 2 cut(s) 56, 57
EarI CTCTTC 2 cut(s) 56, 57
Eco57I CTGAAG 1 cut(s) 25
EcoRI GAATTC 2 cut(s) 82, 170
FaeI CATG 2 cut(s) 290, 301
FaiI YATR 4 cut(s) 191, 288, 299, 376
FatI CATG 2 cut(s) 286, 297
FokI GGATG 1 cut(s) 281
FspBI CTAG 1 cut(s) 96
HapII CCGG 3 cut(s) 87, 107, 257
Hin1II CATG 2 cut(s) 290, 301
HinfI GANTC 6 cut(s) 20, 36, 119, 127, 164, 307
HpaII CCGG 3 cut(s) 87, 107, 257
HphI GGTGA 2 cut(s) 197, 316
Hpy188I TCNGA 7 cut(s) 19, 35, 75, 124, 132, 169, 202
Hpy99I CGWCG 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 103
HpyCH4V TGCA 2 cut(s) 330, 345
HpyF3I CTNAG 3 cut(s) 9, 123, 199
Hsp92II CATG 2 cut(s) 290, 301
Kzo9I GATC 1 cut(s) 195
LpnPI CCDG 4 cut(s) 100, 120, 245, 270
MaeI CTAG 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 137
MalI GATC 1 cut(s) 197
MboI GATC 1 cut(s) 195
MboII GAAGA 4 cut(s) 31, 43, 71, 74
MflI RGATCY 1 cut(s) 195
MluCI AATT 5 cut(s) 82, 170, 208, 221, 361
MlyI GAGTC 1 cut(s) 14
MmeI TCCRAC 1 cut(s) 42
MnlI CCTC 2 cut(s) 72, 294
MseI TTAA 2 cut(s) 219, 248
MslI CAYNNNNRTG 1 cut(s) 302
MspI CCGG 3 cut(s) 87, 107, 257
NdeII GATC 1 cut(s) 195
NlaIII CATG 2 cut(s) 290, 301
PfeI GAWTC 5 cut(s) 36, 119, 127, 164, 307
PleI GAGTC 1 cut(s) 14
PpsI GAGTC 1 cut(s) 14
PsiI TTATAA 1 cut(s) 376
PsuI RGATCY 1 cut(s) 195
RsaI GTAC 2 cut(s) 105, 230
RsaNI GTAC 2 cut(s) 104, 229
RseI CAYNNNNRTG 1 cut(s) 302
SaqAI TTAA 2 cut(s) 219, 248
Sau3AI GATC 1 cut(s) 195
SchI GAGTC 1 cut(s) 14
SetI ASST 1 cut(s) 118
SmiMI CAYNNNNRTG 1 cut(s) 302
Sse9I AATT 5 cut(s) 82, 170, 208, 221, 361
SsiI CCGC 1 cut(s) 266
SspI AATATT 1 cut(s) 246
SspMI CTAG 1 cut(s) 96
TaaI ACNGT 1 cut(s) 103
TaqI TCGA 2 cut(s) 57, 337
TasI AATT 5 cut(s) 82, 170, 208, 221, 361
TfiI GAWTC 5 cut(s) 36, 119, 127, 164, 307
Tru1I TTAA 2 cut(s) 219, 248
Tru9I TTAA 2 cut(s) 219, 248
TscAI CASTG 1 cut(s) 106
TspGWI ACGGA 1 cut(s) 13
TspRI CASTG 1 cut(s) 106
XapI RAATTY 4 cut(s) 82, 170, 208, 221
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.