Rmu_sc0003180.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003180.1
OG0025549
Physical Location & Seq
Reverse (-)
19479 .. 20186
708 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 708 bp
atgcaagttccctatagtggtagaatatcaccgccctaccatggtccacaacatgatttctcacagaaatttggggatccttctgggaagttctatgaaagaagctctaataatatttcagagaacaacaacaaaagttgttatcctcaacttccaatcaacaggattctcaactacaacaagaaaaacaatggcaaagtgaagactttttcacagcagcaaaatggtggttttcagcaaaataacaaattgcaacatcttggtgcccttacacaggagagagaaaatattgacttgaataagggtgttgcagagaatatgggaaaacatgtcactgcggcggaaataaataagaaggctggaatcaaaggggctgaagatagcttggacaagatcatgcttaaacctatgcacaggttagaaagagagaaaatgcaagtcttggcaaagggaaacaattatcaatatcgtacacttgaaaggaaaaaaggaggaaacaatgttacagaatgtgagagcttggacaaagttttagtaaaacatgttcccaggctggagaaagagaagatgaagatgaaatttggtgccttcacaaaacttggtgttgtgcctcctgcaaccaacatgaatcaatctcaacacaatggttccggctctactgtagaatgtcaagcccaggctgccttctcacctttaaaccaatgctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

235

Amino Acids

26.41

Weight (kDa)

9.62

Isoelectric Point (pI)

47.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025549)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002973.1_g000005 Rmu_sc0003180.1_g000002
rosa_roxburghii Rroxscaffold_6G00430750

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 263, 584
AciI CCGC 3 cut(s) 32, 338, 341
AclWI GGATC 2 cut(s) 71, 84
AcsI RAATTY 2 cut(s) 68, 578
AcuI CTGAAG 1 cut(s) 396
AfaI GTAC 1 cut(s) 472
AfiI CCNNNNNNNGG 3 cut(s) 17, 41, 274
AflIII ACRYGT 2 cut(s) 328, 541
AgsI TTSAA 2 cut(s) 298, 479
AjnI CCWGG 2 cut(s) 548, 675
AluBI AGCT 3 cut(s) 105, 384, 519
AluI AGCT 3 cut(s) 105, 384, 519
AlwI GGATC 2 cut(s) 71, 84
ApeKI GCWGC 2 cut(s) 217, 680
ApoI RAATTY 2 cut(s) 68, 578
AspS9I GGNCC 1 cut(s) 44
AsuHPI GGTGA 2 cut(s) 21, 681
AvaII GGWCC 1 cut(s) 44
BaeGI GKGCMC 1 cut(s) 268
BamHI GGATCC 1 cut(s) 76
BanI GGYRCC 2 cut(s) 263, 584
BbsI GAAGAC 1 cut(s) 209
BbvI GCAGC 2 cut(s) 229, 667
BciT130I CCWGG 2 cut(s) 550, 677
BfaI CTAG 1 cut(s) 706
BfmI CTRYAG 2 cut(s) 13, 660
BisI GCNGC 3 cut(s) 218, 339, 681
BlsI GCNGC 3 cut(s) 219, 340, 682
Bme1390I CCNGG 2 cut(s) 550, 677
Bme18I GGWCC 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 44
BmiI GGNNCC 4 cut(s) 78, 265, 586, 649
BmrFI CCNGG 2 cut(s) 550, 677
BpiI GAAGAC 1 cut(s) 209
BpmI CTGGAG 1 cut(s) 575
BsaJI CCNNGG 3 cut(s) 40, 548, 675
Bsc4I CCNNNNNNNGG 3 cut(s) 17, 41, 274
BseBI CCWGG 2 cut(s) 550, 677
BseDI CCNNGG 3 cut(s) 40, 548, 675
BseLI CCNNNNNNNGG 3 cut(s) 17, 41, 274
BseSI GKGCMC 1 cut(s) 268
BseXI GCAGC 2 cut(s) 229, 667
BshNI GGYRCC 2 cut(s) 263, 584
BsiSI CCGG 1 cut(s) 651
BslI CCNNNNNNNGG 3 cut(s) 17, 41, 274
Bsp1286I GDGCHC 1 cut(s) 268
Bsp143I GATC 2 cut(s) 76, 393
Bsp19I CCATGG 1 cut(s) 40
BspACI CCGC 3 cut(s) 32, 338, 341
BspLI GGNNCC 4 cut(s) 78, 265, 586, 649
BspPI GGATC 2 cut(s) 71, 84
BspT107I GGYRCC 2 cut(s) 263, 584
BssECI CCNNGG 3 cut(s) 40, 548, 675
BssMI GATC 2 cut(s) 76, 393
BssT1I CCWWGG 1 cut(s) 40
Bst2UI CCWGG 2 cut(s) 550, 677
Bst4CI ACNGT 1 cut(s) 661
BstDSI CCRYGG 1 cut(s) 40
BstENI CCTNNNNNAGG 1 cut(s) 272
BstKTI GATC 2 cut(s) 79, 396
BstMBI GATC 2 cut(s) 76, 393
BstMWI GCNNNNNNNGC 1 cut(s) 680
BstNI CCWGG 2 cut(s) 550, 677
BstNSI RCATGY 2 cut(s) 332, 545
BstSCI CCNGG 2 cut(s) 548, 675
BstSFI CTRYAG 2 cut(s) 13, 660
BstSLI GKGCMC 1 cut(s) 268
BstV1I GCAGC 2 cut(s) 229, 667
BstV2I GAAGAC 1 cut(s) 209
BstX2I RGATCY 1 cut(s) 76
BstYI RGATCY 1 cut(s) 76
BtgI CCRYGG 1 cut(s) 40
BtsI GCAGTG 1 cut(s) 333
BtsIMutI CAGTG 1 cut(s) 333
Cfr13I GGNCC 1 cut(s) 44
Csp6I GTAC 1 cut(s) 471
CviAII CATG 6 cut(s) 41, 53, 329, 397, 542, 625
CviJI RGCY 9 cut(s) 105, 359, 374, 384, 519, 553, 654, 674, 680
CviKI_1 RGCY 9 cut(s) 105, 359, 374, 384, 519, 553, 654, 674, 680
CviQI GTAC 1 cut(s) 471
DpnI GATC 2 cut(s) 78, 395
DpnII GATC 2 cut(s) 76, 393
DraI TTTAAA 1 cut(s) 696
EciI GGCGGA 1 cut(s) 356
Eco130I CCWWGG 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 44
Eco57I CTGAAG 1 cut(s) 396
EcoNI CCTNNNNNAGG 1 cut(s) 272
EcoRII CCWGG 2 cut(s) 548, 675
EcoT14I CCWWGG 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 40
FaeI CATG 6 cut(s) 44, 56, 332, 400, 545, 628
FatI CATG 6 cut(s) 40, 52, 328, 396, 541, 624
Fnu4HI GCNGC 3 cut(s) 218, 339, 681
Fsp4HI GCNGC 3 cut(s) 218, 339, 681
FspBI CTAG 1 cut(s) 706
GluI GCNGC 3 cut(s) 218, 339, 681
GsuI CTGGAG 1 cut(s) 575
HapII CCGG 1 cut(s) 651
Hin1II CATG 6 cut(s) 44, 56, 332, 400, 545, 628
HinfI GANTC 3 cut(s) 166, 363, 628
HpaII CCGG 1 cut(s) 651
HphI GGTGA 2 cut(s) 21, 681
Hpy166II GTNNAC 2 cut(s) 47, 473
Hpy188I TCNGA 1 cut(s) 121
Hpy8I GTNNAC 2 cut(s) 47, 473
HpyAV CCTTC 4 cut(s) 90, 349, 598, 694
HpyCH4III ACNGT 1 cut(s) 661
HpyCH4V TGCA 6 cut(s) 4, 253, 311, 412, 436, 617
HpyF10VI GCNNNNNNNGC 1 cut(s) 680
Hsp92II CATG 6 cut(s) 44, 56, 332, 400, 545, 628
Kzo9I GATC 2 cut(s) 76, 393
Lsp1109I GCAGC 2 cut(s) 229, 667
MaeI CTAG 1 cut(s) 706
MaeIII GTNAC 2 cut(s) 331, 502
MalI GATC 2 cut(s) 78, 395
MboI GATC 2 cut(s) 76, 393
MboII GAAGA 4 cut(s) 214, 389, 577, 583
MflI RGATCY 1 cut(s) 76
MhlI GDGCHC 1 cut(s) 268
MluCI AATT 4 cut(s) 68, 248, 457, 578
MnlI CCTC 3 cut(s) 156, 485, 621
MseI TTAA 2 cut(s) 402, 695
MslI CAYNNNNRTG 1 cut(s) 261
MspI CCGG 1 cut(s) 651
MspR9I CCNGG 2 cut(s) 550, 677
MvaI CCWGG 2 cut(s) 550, 677
MwoI GCNNNNNNNGC 1 cut(s) 680
NcoI CCATGG 1 cut(s) 40
NdeII GATC 2 cut(s) 76, 393
NlaIII CATG 6 cut(s) 44, 56, 332, 400, 545, 628
NlaIV GGNNCC 4 cut(s) 78, 265, 586, 649
NmuCI GTSAC 1 cut(s) 331
NspI RCATGY 2 cut(s) 332, 545
PciI ACATGT 2 cut(s) 328, 541
PfeI GAWTC 3 cut(s) 166, 363, 628
PkrI GCNGC 3 cut(s) 219, 340, 682
PscI ACATGT 2 cut(s) 328, 541
Psp6I CCWGG 2 cut(s) 548, 675
PspGI CCWGG 2 cut(s) 548, 675
PspN4I GGNNCC 4 cut(s) 78, 265, 586, 649
PspPI GGNCC 1 cut(s) 44
PsrI GAACNNNNNNTAC 2 cut(s) 528, 560
PsuI RGATCY 1 cut(s) 76
RsaI GTAC 1 cut(s) 472
RsaNI GTAC 1 cut(s) 471
RseI CAYNNNNRTG 1 cut(s) 261
SaqAI TTAA 2 cut(s) 402, 695
SatI GCNGC 3 cut(s) 218, 339, 681
Sau3AI GATC 2 cut(s) 76, 393
Sau96I GGNCC 1 cut(s) 44
ScrFI CCNGG 2 cut(s) 550, 677
SduI GDGCHC 1 cut(s) 268
SetI ASST 6 cut(s) 107, 386, 409, 419, 521, 694
SfcI CTRYAG 2 cut(s) 13, 660
SinI GGWCC 1 cut(s) 44
SmiMI CAYNNNNRTG 1 cut(s) 261
Sse9I AATT 4 cut(s) 68, 248, 457, 578
SsiI CCGC 3 cut(s) 32, 338, 341
SspI AATATT 2 cut(s) 115, 289
SspMI CTAG 1 cut(s) 706
StyD4I CCNGG 2 cut(s) 548, 675
StyI CCWWGG 1 cut(s) 40
TaaI ACNGT 1 cut(s) 661
TasI AATT 4 cut(s) 68, 248, 457, 578
TauI GCSGC 1 cut(s) 341
TfiI GAWTC 3 cut(s) 166, 363, 628
Tru1I TTAA 2 cut(s) 402, 695
Tru9I TTAA 2 cut(s) 402, 695
TscAI CASTG 1 cut(s) 340
TseFI GTSAC 1 cut(s) 331
TseI GCWGC 2 cut(s) 217, 680
Tsp45I GTSAC 1 cut(s) 331
TspDTI ATGAA 4 cut(s) 111, 584, 590, 641
TspRI CASTG 1 cut(s) 340
VpaK11BI GGWCC 1 cut(s) 44
XagI CCTNNNNNAGG 1 cut(s) 272
XapI RAATTY 2 cut(s) 68, 578
XceI RCATGY 2 cut(s) 332, 545
XspI CTAG 1 cut(s) 706
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.