Rmu_sc0003270.1_g000027

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003270.1
N/A
Physical Location & Seq
Reverse (-)
80019 .. 80321
303 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 303 bp
atgcaagaagcatacagaaaagacgtggagagagcatttggtatccaagctcgttgggcaatcataagaggaccagctcgtgggtggagtaaggagatccttcaatacatcatggtgacgtgcattatcttgcacaatatgattgttaaagatgagcatgatgaagatgtagcgcaaccatttgatccggatgatatcccaaccagaccaaggaaagcagagatatataagagaccagtaatggacaccgatgttgatagcaatccgcaacaactaaatcaattcttgcgtcgttatatatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

100

Amino Acids

11.87

Weight (kDa)

6.08

Isoelectric Point (pI)

46.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Plant_tran PF04827 2 - 55 5.5e-19 Plant transposon protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 80
AccIII TCCGGA 1 cut(s) 187
AciI CCGC 1 cut(s) 266
AclWI GGATC 2 cut(s) 91, 179
AfiI CCNNNNNNNGG 2 cut(s) 80, 210
AgsI TTSAA 1 cut(s) 104
AjiI CACGTC 2 cut(s) 25, 120
AluBI AGCT 2 cut(s) 50, 77
AluI AGCT 2 cut(s) 50, 77
Alw26I GTCTC 1 cut(s) 226
AlwI GGATC 2 cut(s) 91, 179
Aor13HI TCCGGA 1 cut(s) 187
AspLEI GCGC 1 cut(s) 175
AspS9I GGNCC 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 127
AvaII GGWCC 1 cut(s) 71
BauI CACGAG 1 cut(s) 78
BciVI GTATCC 1 cut(s) 53
BcoDI GTCTC 1 cut(s) 226
BfuI GTATCC 1 cut(s) 53
Bme18I GGWCC 1 cut(s) 71
BmgBI CACGTC 2 cut(s) 25, 120
BmgT120I GGNCC 1 cut(s) 71
BsaBI GATNNNNATC 1 cut(s) 261
BsaI GGTCTC 1 cut(s) 226
BsaJI CCNNGG 1 cut(s) 209
BsaWI WCCGGW 1 cut(s) 187
Bsc4I CCNNNNNNNGG 2 cut(s) 80, 210
Bse1I ACTGG 1 cut(s) 236
Bse8I GATNNNNATC 1 cut(s) 261
BseAI TCCGGA 1 cut(s) 187
BseDI CCNNGG 1 cut(s) 209
BseGI GGATG 1 cut(s) 196
BseJI GATNNNNATC 1 cut(s) 261
BseLI CCNNNNNNNGG 2 cut(s) 80, 210
BseNI ACTGG 1 cut(s) 236
BsiSI CCGG 1 cut(s) 188
BslI CCNNNNNNNGG 2 cut(s) 80, 210
BsmAI GTCTC 1 cut(s) 226
Bso31I GGTCTC 1 cut(s) 226
Bsp13I TCCGGA 1 cut(s) 187
Bsp143I GATC 2 cut(s) 96, 184
BspACI CCGC 1 cut(s) 266
BspEI TCCGGA 1 cut(s) 187
BspPI GGATC 2 cut(s) 91, 179
BspTNI GGTCTC 1 cut(s) 226
BsrI ACTGG 1 cut(s) 236
BssECI CCNNGG 1 cut(s) 209
BssMI GATC 2 cut(s) 96, 184
BssSI CACGAG 1 cut(s) 78
BssT1I CCWWGG 1 cut(s) 209
Bst2BI CACGAG 1 cut(s) 78
BstF5I GGATG 1 cut(s) 196
BstHHI GCGC 1 cut(s) 175
BstKTI GATC 2 cut(s) 99, 187
BstMAI GTCTC 1 cut(s) 226
BstMBI GATC 2 cut(s) 96, 184
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstX2I RGATCY 1 cut(s) 96
BstYI RGATCY 1 cut(s) 96
BsuI GTATCC 1 cut(s) 53
BtrI CACGTC 2 cut(s) 25, 120
BtsCI GGATG 1 cut(s) 196
CfoI GCGC 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 71
CseI GACGC 1 cut(s) 278
CviAII CATG 2 cut(s) 112, 158
CviJI RGCY 2 cut(s) 50, 77
CviKI_1 RGCY 2 cut(s) 50, 77
DpnI GATC 2 cut(s) 98, 186
DpnII GATC 2 cut(s) 96, 184
Eco130I CCWWGG 1 cut(s) 209
Eco31I GGTCTC 1 cut(s) 226
Eco32I GATATC 1 cut(s) 196
Eco47I GGWCC 1 cut(s) 71
EcoRV GATATC 1 cut(s) 196
EcoT14I CCWWGG 1 cut(s) 209
ErhI CCWWGG 1 cut(s) 209
FaeI CATG 2 cut(s) 115, 161
FatI CATG 2 cut(s) 111, 157
FokI GGATG 1 cut(s) 203
GlaI GCGC 1 cut(s) 174
HapII CCGG 1 cut(s) 188
HgaI GACGC 1 cut(s) 278
HhaI GCGC 1 cut(s) 175
Hin1II CATG 2 cut(s) 115, 161
Hin6I GCGC 1 cut(s) 173
HinP1I GCGC 1 cut(s) 173
HpaII CCGG 1 cut(s) 188
HphI GGTGA 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 188
Hpy99I CGWCG 1 cut(s) 294
HpyAV CCTTC 1 cut(s) 110
HpyCH4IV ACGT 2 cut(s) 24, 119
HpyCH4V TGCA 3 cut(s) 4, 123, 133
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpySE526I ACGT 2 cut(s) 24, 119
Hsp92II CATG 2 cut(s) 115, 161
HspAI GCGC 1 cut(s) 173
Kpn2I TCCGGA 1 cut(s) 187
Kzo9I GATC 2 cut(s) 96, 184
LpnPI CCDG 4 cut(s) 87, 201, 217, 249
MaeII ACGT 2 cut(s) 24, 119
MaeIII GTNAC 1 cut(s) 115
MalI GATC 2 cut(s) 98, 186
MboI GATC 2 cut(s) 96, 184
MboII GAAGA 1 cut(s) 176
MflI RGATCY 1 cut(s) 96
MluCI AATT 1 cut(s) 281
MnlI CCTC 1 cut(s) 62
MroI TCCGGA 1 cut(s) 187
MseI TTAA 1 cut(s) 147
MslI CAYNNNNRTG 1 cut(s) 113
MspI CCGG 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 56
NdeII GATC 2 cut(s) 96, 184
NlaIII CATG 2 cut(s) 115, 161
NmuCI GTSAC 1 cut(s) 115
PflMI CCANNNNNTGG 1 cut(s) 80
PspPI GGNCC 1 cut(s) 71
PsuI RGATCY 1 cut(s) 96
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 2 cut(s) 96, 184
Sau96I GGNCC 1 cut(s) 71
SetI ASST 4 cut(s) 27, 52, 79, 122
SinI GGWCC 1 cut(s) 71
SmiMI CAYNNNNRTG 1 cut(s) 113
Sse9I AATT 1 cut(s) 281
SsiI CCGC 1 cut(s) 266
StyI CCWWGG 1 cut(s) 209
TaiI ACGT 2 cut(s) 27, 122
TasI AATT 1 cut(s) 281
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TseFI GTSAC 1 cut(s) 115
Tsp45I GTSAC 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 177
Van91I CCANNNNNTGG 1 cut(s) 80
VpaK11BI GGWCC 1 cut(s) 71
XcmI CCANNNNNNNNNTGG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.