Rmu_sc0003313.1_g000019

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003313.1
N/A
Physical Location & Seq
Reverse (-)
67707 .. 67994
288 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 288 bp
atgactcgtcatatggatgattcgcaccagtacgagtgtatgaatgaagaagaccccagaaggctgtgggtctcactcgaagaaagatttggcaacgtccgtgactccttgcttcctgacctagaagtgagatggcatagcctccgcttctatgatttcaagtcagttcttgactacaactcagaagcacttcgcattaaatccttaatggaattatgtggtaaagagatcacaaatacgatgttgattgagaagactctttctacctccctgacgtctatgcattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

95

Amino Acids

11.37

Weight (kDa)

5.28

Isoelectric Point (pI)

64.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 278
AciI CCGC 1 cut(s) 145
AcyI GRCGYC 1 cut(s) 275
AfaI GTAC 1 cut(s) 32
AgsI TTSAA 1 cut(s) 160
AjuI GAANNNNNNNTTGG 2 cut(s) 72, 104
Alw26I GTCTC 1 cut(s) 76
Asp700I GAANNNNTTC 1 cut(s) 189
BbsI GAAGAC 2 cut(s) 57, 260
BccI CCATC 1 cut(s) 126
BcoDI GTCTC 1 cut(s) 76
BfaI CTAG 1 cut(s) 122
BpiI GAAGAC 2 cut(s) 57, 260
BsaHI GRCGYC 1 cut(s) 275
BsaI GGTCTC 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 28
BseGI GGATG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 195
BseNI ACTGG 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 76
Bso31I GGTCTC 1 cut(s) 76
Bsp143I GATC 1 cut(s) 228
BspACI CCGC 1 cut(s) 145
BspCNI CTCAG 1 cut(s) 194
BspTNI GGTCTC 1 cut(s) 76
BsrI ACTGG 1 cut(s) 28
BssMI GATC 1 cut(s) 228
BssNI GRCGYC 1 cut(s) 275
BstACI GRCGYC 1 cut(s) 275
BstDEI CTNAG 1 cut(s) 181
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 1 cut(s) 231
BstMAI GTCTC 1 cut(s) 76
BstMBI GATC 1 cut(s) 228
BstV2I GAAGAC 2 cut(s) 57, 260
BtsCI GGATG 1 cut(s) 22
Csp6I GTAC 1 cut(s) 31
CviJI RGCY 2 cut(s) 64, 141
CviKI_1 RGCY 2 cut(s) 64, 141
CviQI GTAC 1 cut(s) 31
DdeI CTNAG 1 cut(s) 181
DpnI GATC 1 cut(s) 230
DpnII GATC 1 cut(s) 228
Eco31I GGTCTC 1 cut(s) 76
EcoT22I ATGCAT 1 cut(s) 285
FaiI YATR 7 cut(s) 12, 14, 41, 138, 153, 217, 281
FauNDI CATATG 1 cut(s) 12
FokI GGATG 1 cut(s) 29
FspBI CTAG 1 cut(s) 122
Hin1I GRCGYC 1 cut(s) 275
HinfI GANTC 4 cut(s) 4, 20, 104, 256
Hpy188I TCNGA 1 cut(s) 184
Hpy188III TCNNGA 2 cut(s) 116, 170
HpyAV CCTTC 1 cut(s) 54
HpyCH4IV ACGT 2 cut(s) 96, 275
HpyCH4V TGCA 1 cut(s) 283
HpyF3I CTNAG 1 cut(s) 181
HpySE526I ACGT 2 cut(s) 96, 275
Hsp92I GRCGYC 1 cut(s) 275
Kzo9I GATC 1 cut(s) 228
LpnPI CCDG 4 cut(s) 41, 70, 129, 284
MaeI CTAG 1 cut(s) 122
MaeII ACGT 2 cut(s) 96, 275
MaeIII GTNAC 1 cut(s) 101
MalI GATC 1 cut(s) 230
MboI GATC 1 cut(s) 228
MboII GAAGA 4 cut(s) 59, 62, 92, 265
MluCI AATT 1 cut(s) 212
MlyI GAGTC 2 cut(s) 98, 250
MnlI CCTC 2 cut(s) 152, 277
Mph1103I ATGCAT 1 cut(s) 285
MroXI GAANNNNTTC 1 cut(s) 189
MseI TTAA 2 cut(s) 198, 206
MslI CAYNNNNRTG 1 cut(s) 15
NdeI CATATG 1 cut(s) 12
NdeII GATC 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 101
NsiI ATGCAT 1 cut(s) 285
PdmI GAANNNNTTC 1 cut(s) 189
PfeI GAWTC 1 cut(s) 20
PleI GAGTC 2 cut(s) 98, 250
PpsI GAGTC 2 cut(s) 98, 250
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
RseI CAYNNNNRTG 1 cut(s) 15
SaqAI TTAA 2 cut(s) 198, 206
Sau3AI GATC 1 cut(s) 228
SchI GAGTC 2 cut(s) 98, 250
SetI ASST 4 cut(s) 99, 123, 269, 278
SmiMI CAYNNNNRTG 1 cut(s) 15
Sse9I AATT 1 cut(s) 212
SsiI CCGC 1 cut(s) 145
SspMI CTAG 1 cut(s) 122
TaiI ACGT 2 cut(s) 99, 278
TaqI TCGA 1 cut(s) 78
TasI AATT 1 cut(s) 212
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 2 cut(s) 198, 206
Tru9I TTAA 2 cut(s) 198, 206
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 2 cut(s) 56, 60
TspGWI ACGGA 1 cut(s) 89
XmnI GAANNNNTTC 1 cut(s) 189
XspI CTAG 1 cut(s) 122
ZraI GACGTC 1 cut(s) 276
Zsp2I ATGCAT 1 cut(s) 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.