Rmu_sc0003539.1_g000021

Protein trichome berefringence-like 7

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003539.1
N/A
Physical Location & Seq
Forward (+)
77422 .. 78464
1043 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 474 bp
atggaaaaaagaagtgagcctaactttgattcagacaggggctgctattttcaggttggtaaatcactgaagcttggaatgccgatcaccactgccttcaaaaaagctatgaacacttgggcatcttgggttgagacctcaatcaacacaaatagaacaagtgtcttcttcaggacttttgagtcatcacattggagtggccgacaccgtcattcttgcaaagtgggtcaacgcccttggttaagctcctggggaatggaccgaagcccagtttcagacaccattattaaggttgtgaggaaaatggcagttcctgtaacaattatgcatgttacacctatgggagcattccgaagtgatggtcatgtgggtatttggagtgataatccatctgtgcctgattgtagccattggtgcctacctggcgtacctgatatgtggaatgaaattctcttgtcatatctgctaccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PC-Esterase PMR5N

Protein Analysis

157

Amino Acids

17.89

Weight (kDa)

9.23

Isoelectric Point (pI)

43.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PC-Esterase PF13839 8 - 153 1.4e-38 GDSL/SGNH-like Acyl-Esterase family found in Pmr5 and Cas1p
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 181
AccB1I GGYRCC 1 cut(s) 414
AcoI YGGCCR 1 cut(s) 199
AcsI RAATTY 1 cut(s) 447
AcuI CTGAAG 2 cut(s) 89, 154
AfaI GTAC 1 cut(s) 429
AgsI TTSAA 1 cut(s) 100
AjnI CCWGG 2 cut(s) 248, 421
AluBI AGCT 3 cut(s) 73, 107, 246
AluI AGCT 3 cut(s) 73, 107, 246
Alw26I GTCTC 1 cut(s) 128
AlwNI CAGNNNCTG 2 cut(s) 42, 314
AoxI GGCC 1 cut(s) 199
ApeKI GCWGC 1 cut(s) 42
ApoI RAATTY 1 cut(s) 447
ArsI GACNNNNNNTTYG 2 cut(s) 346, 378
AspS9I GGNCC 1 cut(s) 259
AsuHPI GGTGA 1 cut(s) 79
AvaII GGWCC 1 cut(s) 259
BanI GGYRCC 1 cut(s) 414
BbsI GAAGAC 1 cut(s) 157
BbvI GCAGC 1 cut(s) 29
BccI CCATC 2 cut(s) 353, 397
BciT130I CCWGG 2 cut(s) 250, 423
BcoDI GTCTC 1 cut(s) 128
BglI GCCNNNNNGGC 1 cut(s) 423
BisI GCNGC 1 cut(s) 43
BlsI GCNGC 1 cut(s) 44
Bme1390I CCNGG 2 cut(s) 250, 423
Bme18I GGWCC 1 cut(s) 259
BmgT120I GGNCC 1 cut(s) 259
BmiI GGNNCC 1 cut(s) 416
BmrFI CCNGG 2 cut(s) 250, 423
BmrI ACTGGG 1 cut(s) 263
BmsI GCATC 1 cut(s) 131
BmuI ACTGGG 1 cut(s) 263
BpiI GAAGAC 1 cut(s) 157
BsaI GGTCTC 1 cut(s) 128
BsaJI CCNNGG 2 cut(s) 236, 249
Bse1I ACTGG 1 cut(s) 269
BseBI CCWGG 2 cut(s) 250, 423
BseDI CCNNGG 2 cut(s) 236, 249
BseNI ACTGG 1 cut(s) 269
BseXI GCAGC 1 cut(s) 29
BshFI GGCC 1 cut(s) 201
BshNI GGYRCC 1 cut(s) 414
BsmAI GTCTC 1 cut(s) 128
BsmI GAATGC 2 cut(s) 84, 347
BsnI GGCC 1 cut(s) 201
Bso31I GGTCTC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 84
BspANI GGCC 1 cut(s) 201
BspLI GGNNCC 1 cut(s) 416
BspT107I GGYRCC 1 cut(s) 414
BspTNI GGTCTC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 269
BssECI CCNNGG 2 cut(s) 236, 249
BssMI GATC 1 cut(s) 84
BssT1I CCWWGG 1 cut(s) 236
Bst2UI CCWGG 2 cut(s) 250, 423
Bst4CI ACNGT 1 cut(s) 209
BstKTI GATC 1 cut(s) 87
BstMAI GTCTC 1 cut(s) 128
BstMBI GATC 1 cut(s) 84
BstMWI GCNNNNNNNGC 3 cut(s) 79, 414, 423
BstNI CCWGG 2 cut(s) 250, 423
BstNSI RCATGY 1 cut(s) 332
BstSCI CCNGG 2 cut(s) 248, 421
BstV1I GCAGC 1 cut(s) 29
BstV2I GAAGAC 1 cut(s) 157
BsuRI GGCC 1 cut(s) 201
BtsI GCAGTG 1 cut(s) 90
BtsIMutI CAGTG 2 cut(s) 65, 90
CaiI CAGNNNCTG 2 cut(s) 42, 314
Cfr13I GGNCC 1 cut(s) 259
Csp6I GTAC 1 cut(s) 428
CviAII CATG 3 cut(s) 329, 365, 471
CviJI RGCY 8 cut(s) 19, 42, 73, 107, 201, 246, 267, 408
CviKI_1 RGCY 8 cut(s) 19, 42, 73, 107, 201, 246, 267, 408
CviQI GTAC 1 cut(s) 428
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
DrdI GACNNNNNNGTC 1 cut(s) 181
DseDI GACNNNNNNGTC 1 cut(s) 181
EaeI YGGCCR 1 cut(s) 199
Eco130I CCWWGG 1 cut(s) 236
Eco31I GGTCTC 1 cut(s) 128
Eco47I GGWCC 1 cut(s) 259
Eco57I CTGAAG 2 cut(s) 89, 154
EcoRII CCWGG 2 cut(s) 248, 421
EcoT14I CCWWGG 1 cut(s) 236
EcoT22I ATGCAT 1 cut(s) 330
ErhI CCWWGG 1 cut(s) 236
FaeI CATG 3 cut(s) 332, 368, 474
FaiI YATR 8 cut(s) 110, 326, 330, 341, 366, 437, 460, 472
FatI CATG 3 cut(s) 328, 364, 470
Fnu4HI GCNGC 1 cut(s) 43
Fsp4HI GCNGC 1 cut(s) 43
GluI GCNGC 1 cut(s) 43
HaeIII GGCC 1 cut(s) 201
Hin1II CATG 3 cut(s) 332, 368, 474
HincII GTYRAC 1 cut(s) 230
HindII GTYRAC 1 cut(s) 230
HindIII AAGCTT 1 cut(s) 71
HinfI GANTC 2 cut(s) 29, 182
HphI GGTGA 1 cut(s) 79
Hpy166II GTNNAC 1 cut(s) 230
Hpy188I TCNGA 3 cut(s) 34, 277, 353
Hpy188III TCNNGA 1 cut(s) 172
Hpy8I GTNNAC 1 cut(s) 230
HpyAV CCTTC 1 cut(s) 106
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4V TGCA 2 cut(s) 219, 328
HpyF10VI GCNNNNNNNGC 3 cut(s) 79, 414, 423
Hsp92II CATG 3 cut(s) 332, 368, 474
Kzo9I GATC 1 cut(s) 84
LmnI GCTCC 2 cut(s) 251, 344
Lsp1109I GCAGC 1 cut(s) 29
LweI GCATC 1 cut(s) 131
MaeIII GTNAC 2 cut(s) 316, 331
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 2 cut(s) 157, 160
MluCI AATT 2 cut(s) 321, 447
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 2 cut(s) 148, 291
Mph1103I ATGCAT 1 cut(s) 330
MseI TTAA 2 cut(s) 242, 288
MslI CAYNNNNRTG 1 cut(s) 195
MspR9I CCNGG 2 cut(s) 250, 423
Mva1269I GAATGC 2 cut(s) 84, 347
MvaI CCWGG 2 cut(s) 250, 423
MwoI GCNNNNNNNGC 3 cut(s) 79, 414, 423
NdeII GATC 1 cut(s) 84
NlaIII CATG 3 cut(s) 332, 368, 474
NlaIV GGNNCC 1 cut(s) 416
NsiI ATGCAT 1 cut(s) 330
NspI RCATGY 1 cut(s) 332
PctI GAATGC 2 cut(s) 84, 347
PfeI GAWTC 1 cut(s) 29
PflFI GACNNNGTC 1 cut(s) 207
PkrI GCNGC 1 cut(s) 44
PleI GAGTC 1 cut(s) 190
PpsI GAGTC 1 cut(s) 190
Psp6I CCWGG 2 cut(s) 248, 421
PspGI CCWGG 2 cut(s) 248, 421
PspN4I GGNNCC 1 cut(s) 416
PspPI GGNCC 1 cut(s) 259
PstNI CAGNNNCTG 2 cut(s) 42, 314
PsyI GACNNNGTC 1 cut(s) 207
RsaI GTAC 1 cut(s) 429
RsaNI GTAC 1 cut(s) 428
RseI CAYNNNNRTG 1 cut(s) 195
SaqAI TTAA 2 cut(s) 242, 288
SatI GCNGC 1 cut(s) 43
Sau3AI GATC 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 259
SchI GAGTC 1 cut(s) 191
ScrFI CCNGG 2 cut(s) 250, 423
SetI ASST 9 cut(s) 57, 75, 109, 140, 248, 294, 340, 424, 433
SfaNI GCATC 1 cut(s) 131
SinI GGWCC 1 cut(s) 259
SmiMI CAYNNNNRTG 1 cut(s) 195
Sse9I AATT 2 cut(s) 321, 447
StyD4I CCNGG 2 cut(s) 248, 421
StyI CCWWGG 1 cut(s) 236
TaaI ACNGT 1 cut(s) 209
TaqII GACCGA 1 cut(s) 276
TasI AATT 2 cut(s) 321, 447
TfiI GAWTC 1 cut(s) 29
Tru1I TTAA 2 cut(s) 242, 288
Tru9I TTAA 2 cut(s) 242, 288
TscAI CASTG 2 cut(s) 72, 97
TseI GCWGC 1 cut(s) 42
TspDTI ATGAA 2 cut(s) 125, 459
TspRI CASTG 2 cut(s) 72, 97
Tth111I GACNNNGTC 1 cut(s) 207
VpaK11BI GGWCC 1 cut(s) 259
XapI RAATTY 1 cut(s) 447
XceI RCATGY 1 cut(s) 332
Zsp2I ATGCAT 1 cut(s) 330
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.