Rmu_sc0003543.1_g000001

Chaperone protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003543.1
OG0031227
Physical Location & Seq
Reverse (-)
1 .. 739
739 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 285 bp
atggccgccgcggccctctctctcctccctccttcctctcctcacctcctcttcccgccgtcgccgtcgccgtcttcgtcttcatcttcttcctttgctctctgcgggtcccacaagagcttcgcctcactcaattgtactactcgtccgtggaacaagttgagtaggaaacgccgcgttgggacggtgttcgccgcttccggtgattactacgccactctaggggttaataaagccgccactagcaaggaaatcaaaaccgcttatcggagattagctcgccag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ DnaJ_C DnaJ_CXXCXGXG

Protein Analysis

95

Amino Acids

10.12

Weight (kDa)

10.76

Isoelectric Point (pI)

89.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 69 - 95 4.4e-07 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031227)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002792.1_g000020 Rmu_sc0003543.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 11, 177
AciI CCGC 9 cut(s) 6, 9, 11, 56, 105, 175, 195, 237, 261
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 139
AfiI CCNNNNNNNGG 2 cut(s) 222, 267
AluBI AGCT 2 cut(s) 120, 278
AluI AGCT 2 cut(s) 120, 278
AoxI GGCC 2 cut(s) 3, 12
AspS9I GGNCC 2 cut(s) 13, 108
AsuHPI GGTGA 2 cut(s) 35, 215
AvaII GGWCC 1 cut(s) 108
BbsI GAAGAC 2 cut(s) 66, 72
BceAI ACGGC 3 cut(s) 43, 49, 55
BfaI CTAG 2 cut(s) 221, 243
BglI GCCNNNNNGGC 1 cut(s) 11
BisI GCNGC 6 cut(s) 6, 9, 12, 175, 195, 237
BlsI GCNGC 6 cut(s) 7, 10, 13, 176, 196, 238
Bme18I GGWCC 1 cut(s) 108
BmgT120I GGNCC 2 cut(s) 13, 108
BmiI GGNNCC 2 cut(s) 109, 110
BpiI GAAGAC 2 cut(s) 66, 72
BplI GAGNNNNNCTC 1 cut(s) 262
BsaJI CCNNGG 2 cut(s) 9, 149
BsaWI WCCGGW 1 cut(s) 200
Bsc4I CCNNNNNNNGG 2 cut(s) 222, 267
BseDI CCNNGG 2 cut(s) 9, 149
BseLI CCNNNNNNNGG 2 cut(s) 222, 267
BseRI GAGGAG 3 cut(s) 14, 30, 38
Bsh1236I CGCG 2 cut(s) 11, 177
BshFI GGCC 2 cut(s) 5, 14
BsiSI CCGG 1 cut(s) 201
BslFI GGGAC 2 cut(s) 94, 196
BslI CCNNNNNNNGG 2 cut(s) 222, 267
BsmFI GGGAC 2 cut(s) 94, 196
BsnI GGCC 2 cut(s) 5, 14
BspACI CCGC 9 cut(s) 6, 9, 11, 56, 105, 175, 195, 237, 261
BspANI GGCC 2 cut(s) 5, 14
BspFNI CGCG 2 cut(s) 11, 177
BspLI GGNNCC 2 cut(s) 109, 110
BssECI CCNNGG 2 cut(s) 9, 149
Bst4CI ACNGT 1 cut(s) 187
Bst6I CTCTTC 1 cut(s) 56
BstC8I GCNNGC 1 cut(s) 280
BstDSI CCRYGG 2 cut(s) 9, 149
BstFNI CGCG 2 cut(s) 11, 177
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstUI CGCG 2 cut(s) 11, 177
BstV2I GAAGAC 2 cut(s) 66, 72
BsuRI GGCC 2 cut(s) 5, 14
BtgI CCRYGG 2 cut(s) 9, 149
Cac8I GCNNGC 1 cut(s) 280
Cfr13I GGNCC 2 cut(s) 13, 108
Cfr42I CCGCGG 1 cut(s) 12
Csp6I GTAC 1 cut(s) 138
CviJI RGCY 5 cut(s) 5, 14, 120, 236, 278
CviKI_1 RGCY 5 cut(s) 5, 14, 120, 236, 278
CviQI GTAC 1 cut(s) 138
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 56
EarI CTCTTC 1 cut(s) 56
Eco47I GGWCC 1 cut(s) 108
EcoO109I RGGNCCY 1 cut(s) 108
FaqI GGGAC 2 cut(s) 94, 196
FauI CCCGC 2 cut(s) 63, 98
Fnu4HI GCNGC 6 cut(s) 6, 9, 12, 175, 195, 237
Fsp4HI GCNGC 6 cut(s) 6, 9, 12, 175, 195, 237
FspBI CTAG 2 cut(s) 221, 243
GluI GCNGC 6 cut(s) 6, 9, 12, 175, 195, 237
HaeIII GGCC 2 cut(s) 5, 14
HapII CCGG 1 cut(s) 201
HpaII CCGG 1 cut(s) 201
HphI GGTGA 2 cut(s) 35, 215
Hpy188I TCNGA 1 cut(s) 270
Hpy99I CGWCG 2 cut(s) 64, 70
HpyAV CCTTC 1 cut(s) 42
HpyCH4III ACNGT 1 cut(s) 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
KflI GGGWCCC 1 cut(s) 108
KspI CCGCGG 1 cut(s) 12
LpnPI CCDG 1 cut(s) 214
MaeI CTAG 2 cut(s) 221, 243
MboII GAAGA 5 cut(s) 43, 66, 72, 78, 81
MfeI CAATTG 1 cut(s) 133
MluCI AATT 1 cut(s) 133
MnlI CCTC 8 cut(s) 26, 35, 39, 46, 51, 56, 59, 136
MseI TTAA 1 cut(s) 228
MspA1I CMGCKG 1 cut(s) 11
MspI CCGG 1 cut(s) 201
MunI CAATTG 1 cut(s) 133
MvnI CGCG 2 cut(s) 11, 177
MwoI GCNNNNNNNGC 1 cut(s) 11
NlaIV GGNNCC 2 cut(s) 109, 110
PcsI WCGNNNNNNNCGW 2 cut(s) 68, 74
PkrI GCNGC 6 cut(s) 7, 10, 13, 176, 196, 238
PpuMI RGGWCCY 1 cut(s) 108
Psp5II RGGWCCY 1 cut(s) 108
PspN4I GGNNCC 2 cut(s) 109, 110
PspPI GGNCC 2 cut(s) 13, 108
PspPPI RGGWCCY 1 cut(s) 108
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SacII CCGCGG 1 cut(s) 12
SaqAI TTAA 1 cut(s) 228
SatI GCNGC 6 cut(s) 6, 9, 12, 175, 195, 237
Sau96I GGNCC 2 cut(s) 13, 108
SetI ASST 3 cut(s) 48, 122, 280
SfiI GGCCNNNNNGGCC 1 cut(s) 11
Sfr303I CCGCGG 1 cut(s) 12
SgrBI CCGCGG 1 cut(s) 12
SinI GGWCC 1 cut(s) 108
Sse9I AATT 1 cut(s) 133
SsiI CCGC 9 cut(s) 6, 9, 11, 56, 105, 175, 195, 237, 261
SspMI CTAG 2 cut(s) 221, 243
TaaI ACNGT 1 cut(s) 187
TasI AATT 1 cut(s) 133
TatI WGTACW 1 cut(s) 137
TauI GCSGC 6 cut(s) 8, 11, 14, 177, 197, 239
Tru1I TTAA 1 cut(s) 228
Tru9I TTAA 1 cut(s) 228
TspDTI ATGAA 1 cut(s) 72
TspGWI ACGGA 1 cut(s) 138
VpaK11BI GGWCC 1 cut(s) 108
XspI CTAG 2 cut(s) 221, 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.