Rmu_sc0003604.1_g000004

Major allergen Pru

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003604.1
N/A
Physical Location & Seq
Reverse (-)
16414 .. 16879
466 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 384 bp
atgggccgggccgggtttttgcgggctttaggcgggccggccctcggcccaccgaggcgggcttttgcgggttttttgatgggccgggccgggctaaaagccctcagggccggcgggcctccatcggcccacttgatccgcgggctttttgatgaggcctacttggacatgcttcggctttttcccggtgctctagacttggaccttccacgattgttgtttgaattcttgttgaatgttctacctctatcctccatagatagtgcagaacttgaatcccaactccgctacaagattgacagaatagacaaagacaacttggtatataagtacaacatgatcgaaggagatgctatctcaaacaaaattgagaagatctcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bet_v_1

Protein Analysis

127

Amino Acids

14.0

Weight (kDa)

9.04

Isoelectric Point (pI)

40.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 141
AciI CCGC 8 cut(s) 22, 33, 58, 68, 114, 139, 141, 286
AclWI GGATC 1 cut(s) 130
AcsI RAATTY 1 cut(s) 224
AfaI GTAC 1 cut(s) 332
AfiI CCNNNNNNNGG 1 cut(s) 44
AgsI TTSAA 3 cut(s) 224, 235, 275
Alw21I GWGCWC 1 cut(s) 193
AlwI GGATC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 224
AsuC2I CCSGG 5 cut(s) 8, 13, 86, 91, 186
AvaII GGWCC 1 cut(s) 202
AxyI CCTNAGG 1 cut(s) 104
Bbv12I GWGCWC 1 cut(s) 193
BccI CCATC 2 cut(s) 73, 130
BcgI CGANNNNNNTGC 2 cut(s) 332, 366
BcnI CCSGG 5 cut(s) 8, 13, 86, 91, 186
BfaI CTAG 2 cut(s) 194, 382
BglI GCCNNNNNGGC 1 cut(s) 107
BglII AGATCT 1 cut(s) 375
Bme1390I CCNGG 5 cut(s) 8, 13, 86, 91, 186
Bme18I GGWCC 1 cut(s) 202
BmrFI CCNGG 5 cut(s) 8, 13, 86, 91, 186
BmsI GCATC 1 cut(s) 340
BplI GAGNNNNNCTC 1 cut(s) 362
BpuMI CCSGG 5 cut(s) 8, 13, 86, 91, 186
BsaJI CCNNGG 3 cut(s) 43, 53, 139
Bsc4I CCNNNNNNNGG 1 cut(s) 44
Bse118I RCCGGY 2 cut(s) 37, 110
Bse21I CCTNAGG 1 cut(s) 104
BseDI CCNNGG 3 cut(s) 43, 53, 139
BseLI CCNNNNNNNGG 1 cut(s) 44
BseMII CTCAG 1 cut(s) 118
BsgI GTGCAG 1 cut(s) 285
Bsh1236I CGCG 1 cut(s) 141
BsiHKAI GWGCWC 1 cut(s) 193
BsiSI CCGG 7 cut(s) 7, 12, 38, 85, 90, 111, 186
BslI CCNNNNNNNGG 1 cut(s) 44
Bsp1286I GDGCHC 1 cut(s) 193
Bsp143I GATC 3 cut(s) 135, 339, 375
BspACI CCGC 8 cut(s) 22, 33, 58, 68, 114, 139, 141, 286
BspCNI CTCAG 1 cut(s) 117
BspFNI CGCG 1 cut(s) 141
BspPI GGATC 1 cut(s) 130
BsrFI RCCGGY 2 cut(s) 37, 110
BssAI RCCGGY 2 cut(s) 37, 110
BssECI CCNNGG 3 cut(s) 43, 53, 139
BssMI GATC 3 cut(s) 135, 339, 375
BstC8I GCNNGC 7 cut(s) 24, 35, 39, 60, 112, 116, 143
BstDEI CTNAG 1 cut(s) 104
BstDSI CCRYGG 1 cut(s) 139
BstFNI CGCG 1 cut(s) 141
BstKTI GATC 3 cut(s) 138, 342, 378
BstMBI GATC 3 cut(s) 135, 339, 375
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstNSI RCATGY 1 cut(s) 172
BstSCI CCNGG 5 cut(s) 6, 11, 84, 89, 184
BstUI CGCG 1 cut(s) 141
BstX2I RGATCY 1 cut(s) 375
BstYI RGATCY 1 cut(s) 375
Bsu36I CCTNAGG 1 cut(s) 104
BtgI CCRYGG 1 cut(s) 139
Cac8I GCNNGC 7 cut(s) 24, 35, 39, 60, 112, 116, 143
Cfr10I RCCGGY 2 cut(s) 37, 110
Cfr42I CCGCGG 1 cut(s) 142
Csp6I GTAC 1 cut(s) 331
CspCI CAANNNNNGTGG 2 cut(s) 198, 233
CviAII CATG 2 cut(s) 169, 337
CviQI GTAC 1 cut(s) 331
DdeI CTNAG 1 cut(s) 104
DpnI GATC 3 cut(s) 137, 341, 377
DpnII GATC 3 cut(s) 135, 339, 375
Eco147I AGGCCT 1 cut(s) 158
Eco47I GGWCC 1 cut(s) 202
Eco81I CCTNAGG 1 cut(s) 104
EcoRI GAATTC 1 cut(s) 224
FaeI CATG 2 cut(s) 172, 340
FaiI YATR 5 cut(s) 170, 257, 325, 327, 338
FatI CATG 2 cut(s) 168, 336
FauI CCCGC 6 cut(s) 15, 26, 51, 61, 107, 134
FseI GGCCGGCC 1 cut(s) 41
FspBI CTAG 2 cut(s) 194, 382
HapII CCGG 7 cut(s) 7, 12, 38, 85, 90, 111, 186
Hin1II CATG 2 cut(s) 172, 340
HinfI GANTC 1 cut(s) 275
HpaII CCGG 7 cut(s) 7, 12, 38, 85, 90, 111, 186
Hpy188III TCNNGA 1 cut(s) 194
HpyAV CCTTC 2 cut(s) 215, 338
HpyCH4V TGCA 1 cut(s) 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 2 cut(s) 172, 340
KroI GCCGGC 2 cut(s) 37, 110
KroNI GCCGGC 2 cut(s) 39, 112
KspI CCGCGG 1 cut(s) 142
Kzo9I GATC 3 cut(s) 135, 339, 375
LpnPI CCDG 8 cut(s) 20, 25, 51, 91, 98, 103, 124, 199
LweI GCATC 1 cut(s) 340
MaeI CTAG 2 cut(s) 194, 382
MalI GATC 3 cut(s) 137, 341, 377
MboI GATC 3 cut(s) 135, 339, 375
MflI RGATCY 1 cut(s) 375
MhlI GDGCHC 1 cut(s) 193
MluCI AATT 2 cut(s) 224, 366
MnlI CCTC 7 cut(s) 48, 53, 113, 129, 148, 255, 262
MroNI GCCGGC 2 cut(s) 37, 110
MspA1I CMGCKG 1 cut(s) 141
MspI CCGG 7 cut(s) 7, 12, 38, 85, 90, 111, 186
MspR9I CCNGG 5 cut(s) 8, 13, 86, 91, 186
MvnI CGCG 1 cut(s) 141
MwoI GCNNNNNNNGC 1 cut(s) 107
NaeI GCCGGC 2 cut(s) 39, 112
NciI CCSGG 5 cut(s) 8, 13, 86, 91, 186
NdeII GATC 3 cut(s) 135, 339, 375
NgoMIV GCCGGC 2 cut(s) 37, 110
NlaIII CATG 2 cut(s) 172, 340
NmeAIII GCCGAG 1 cut(s) 24
NspI RCATGY 1 cut(s) 172
PceI AGGCCT 1 cut(s) 158
PdiI GCCGGC 2 cut(s) 39, 112
PfeI GAWTC 1 cut(s) 275
PsuI RGATCY 1 cut(s) 375
RigI GGCCGGCC 1 cut(s) 41
RsaI GTAC 1 cut(s) 332
RsaNI GTAC 1 cut(s) 331
SacII CCGCGG 1 cut(s) 142
Sau3AI GATC 3 cut(s) 135, 339, 375
ScrFI CCNGG 5 cut(s) 8, 13, 86, 91, 186
SduI GDGCHC 1 cut(s) 193
SetI ASST 2 cut(s) 207, 247
SfaNI GCATC 1 cut(s) 340
Sfr303I CCGCGG 1 cut(s) 142
SgrBI CCGCGG 1 cut(s) 142
SinI GGWCC 1 cut(s) 202
Sse9I AATT 2 cut(s) 224, 366
SseBI AGGCCT 1 cut(s) 158
SsiI CCGC 8 cut(s) 22, 33, 58, 68, 114, 139, 141, 286
SspMI CTAG 2 cut(s) 194, 382
StuI AGGCCT 1 cut(s) 158
StyD4I CCNGG 5 cut(s) 6, 11, 84, 89, 184
TaqI TCGA 1 cut(s) 342
TasI AATT 2 cut(s) 224, 366
TatI WGTACW 1 cut(s) 330
TfiI GAWTC 1 cut(s) 275
VpaK11BI GGWCC 1 cut(s) 202
XapI RAATTY 1 cut(s) 224
XbaI TCTAGA 1 cut(s) 193
XceI RCATGY 1 cut(s) 172
XspI CTAG 2 cut(s) 194, 382
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.