Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003633.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

132557 .. 134430

Gene Structure 1874 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003633.1_g000039.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 519 bp

atgcatgtttctgtgaatttctcatatctgatttgtgcatccaggattttagccaaccgtcagtcagctgctcgttccaaggagcggaagatgcgatacattgtagaattggaacacaaagtgcaaactctgcagactgaggcaaccactttgtctgcccaggttactaagttgcagagggactctatgggtcttacaagtgagaacaatgagttgaaatttcgtcttcaagccttggagcaacaggcgcaacttaaagatgctttaaacgaggccttgactggagaggtccagcgacttagaatttctgctgcagaactcggaggagaaggcaacctttcaaaccgcatgtcccagcagctttcaattaatcaacaaatgctccaactacagcaactcaacctctaccagatgcagcagcagccgcagcagcaaactcaacaacagataatgcagcaaaatcaactaccttcccatcagcagaatggcaatgctgctaagcatgagtcaatgcaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

bZIP_1 bZIP_2

Protein Analysis

172

Amino Acids

19.66

Weight (kDa)

9.2

Isoelectric Point (pI)

52.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	85
AciI	CCGC	3 cut(s)	85, 346, 425
AcsI	RAATTY	3 cut(s)	16, 218, 303
AdeI	CACNNNGTG	1 cut(s)	121
AfiI	CCNNNNNNNGG	1 cut(s)	84
AgsI	TTSAA	4 cut(s)	217, 230, 342, 366
AjnI	CCWGG	2 cut(s)	41, 159
AluBI	AGCT	2 cut(s)	68, 361
AluI	AGCT	2 cut(s)	68, 361
AoxI	GGCC	1 cut(s)	273
ApoI	RAATTY	3 cut(s)	16, 218, 303
ArsI	GACNNNNNNTTYG	2 cut(s)	335, 367
AseI	ATTAAT	1 cut(s)	369
AspLEI	GCGC	1 cut(s)	250
AspS9I	GGNCC	1 cut(s)	289
AvaII	GGWCC	1 cut(s)	289
BarI	GAAGNNNNNNTAC	2 cut(s)	80, 112
BbsI	GAAGAC	1 cut(s)	218
BccI	CCATC	1 cut(s)	483
BciT130I	CCWGG	2 cut(s)	43, 161
BfmI	CTRYAG	3 cut(s)	131, 312, 389
BlpI	GCTNAGC	1 cut(s)	498
Bme1390I	CCNGG	2 cut(s)	43, 161
Bme18I	GGWCC	1 cut(s)	289
BmgT120I	GGNCC	1 cut(s)	289
BmrFI	CCNGG	2 cut(s)	43, 161
BmsI	GCATC	4 cut(s)	47, 81, 250, 402
BpiI	GAAGAC	1 cut(s)	218
BpmI	CTGGAG	1 cut(s)	303
Bpu1102I	GCTNAGC	1 cut(s)	498
BsaJI	CCNNGG	3 cut(s)	78, 159, 234
BsaXI	ACNNNNNCTCC	2 cut(s)	366, 396
Bsc4I	CCNNNNNNNGG	1 cut(s)	84
Bse1I	ACTGG	1 cut(s)	286
Bse3DI	GCAATG	1 cut(s)	496
BseBI	CCWGG	2 cut(s)	43, 161
BseDI	CCNNGG	3 cut(s)	78, 159, 234
BseGI	GGATG	1 cut(s)	38
BseLI	CCNNNNNNNGG	1 cut(s)	84
BseMI	GCAATG	1 cut(s)	496
BseMII	CTCAG	1 cut(s)	129
BseNI	ACTGG	1 cut(s)	286
BseRI	GAGGAG	1 cut(s)	339
BseYI	CCCAGC	1 cut(s)	354
BshFI	GGCC	1 cut(s)	275
BslFI	GGGAC	2 cut(s)	194, 337
BslI	CCNNNNNNNGG	1 cut(s)	84
BsmFI	GGGAC	2 cut(s)	194, 337
BsnI	GGCC	1 cut(s)	275
Bsp1720I	GCTNAGC	1 cut(s)	498
BspACI	CCGC	3 cut(s)	85, 346, 425
BspANI	GGCC	1 cut(s)	275
BspCNI	CTCAG	1 cut(s)	130
BspMAI	CTGCAG	2 cut(s)	135, 316
BsrBI	CCGCTC	1 cut(s)	85
BsrDI	GCAATG	1 cut(s)	496
BsrI	ACTGG	1 cut(s)	286
BssECI	CCNNGG	3 cut(s)	78, 159, 234
BssT1I	CCWWGG	2 cut(s)	78, 234
Bst2UI	CCWGG	2 cut(s)	43, 161
Bst4CI	ACNGT	1 cut(s)	59
BstAPI	GCANNNNNTGC	1 cut(s)	130
BstDEI	CTNAG	4 cut(s)	138, 168, 299, 498
BstF5I	GGATG	1 cut(s)	38
BstHHI	GCGC	1 cut(s)	250
BstMWI	GCNNNNNNNGC	7 cut(s)	91, 130, 247, 421, 424, 427, 430
BstNI	CCWGG	2 cut(s)	43, 161
BstNSI	RCATGY	2 cut(s)	8, 352
BstSCI	CCNGG	2 cut(s)	41, 159
BstSFI	CTRYAG	3 cut(s)	131, 312, 389
BstV2I	GAAGAC	1 cut(s)	218
BsuRI	GGCC	1 cut(s)	275
BtsCI	GGATG	1 cut(s)	38
CfoI	GCGC	1 cut(s)	250
Cfr13I	GGNCC	1 cut(s)	289
CviAII	CATG	3 cut(s)	5, 349, 503
CviJI	RGCY	6 cut(s)	53, 68, 233, 275, 361, 424
CviKI_1	RGCY	6 cut(s)	53, 68, 233, 275, 361, 424
DdeI	CTNAG	4 cut(s)	138, 168, 299, 498
DraI	TTTAAA	1 cut(s)	267
DraIII	CACNNNGTG	1 cut(s)	121
Eco130I	CCWWGG	2 cut(s)	78, 234
Eco147I	AGGCCT	1 cut(s)	275
Eco47I	GGWCC	1 cut(s)	289
EcoRII	CCWGG	2 cut(s)	41, 159
EcoT14I	CCWWGG	2 cut(s)	78, 234
EcoT22I	ATGCAT	1 cut(s)	6
ErhI	CCWWGG	2 cut(s)	78, 234
FaeI	CATG	3 cut(s)	8, 352, 506
FaiI	YATR	5 cut(s)	6, 25, 188, 350, 504
FalI	AAGNNNNNCTT	2 cut(s)	321, 353
FaqI	GGGAC	2 cut(s)	194, 337
FatI	CATG	3 cut(s)	4, 348, 502
FokI	GGATG	1 cut(s)	25
GlaI	GCGC	1 cut(s)	249
GsaI	CCCAGC	1 cut(s)	358
GsuI	CTGGAG	1 cut(s)	303
HaeIII	GGCC	1 cut(s)	275
HhaI	GCGC	1 cut(s)	250
Hin1II	CATG	3 cut(s)	8, 352, 506
Hin6I	GCGC	1 cut(s)	248
HinP1I	GCGC	1 cut(s)	248
HinfI	GANTC	2 cut(s)	182, 506
Hpy188I	TCNGA	2 cut(s)	30, 323
HpyAV	CCTTC	2 cut(s)	323, 480
HpyCH4III	ACNGT	1 cut(s)	59
HpyCH4V	TGCA	9 cut(s)	4, 38, 124, 133, 175, 314, 415, 454, 514
HpyF10VI	GCNNNNNNNGC	7 cut(s)	91, 130, 247, 421, 424, 427, 430
HpyF3I	CTNAG	4 cut(s)	138, 168, 299, 498
Hsp92II	CATG	3 cut(s)	8, 352, 506
HspAI	GCGC	1 cut(s)	248
LmnI	GCTCC	3 cut(s)	82, 238, 387
LpnPI	CCDG	9 cut(s)	28, 55, 146, 173, 230, 267, 305, 368, 422
LweI	GCATC	4 cut(s)	47, 81, 250, 402
MaeIII	GTNAC	1 cut(s)	163
MbiI	CCGCTC	1 cut(s)	85
MboII	GAAGA	2 cut(s)	100, 218
MluCI	AATT	5 cut(s)	16, 107, 218, 303, 366
MlyI	GAGTC	2 cut(s)	176, 515
MmeI	TCCRAC	1 cut(s)	409
MnlI	CCTC	6 cut(s)	133, 171, 265, 280, 317, 413
Mph1103I	ATGCAT	1 cut(s)	6
MseI	TTAA	3 cut(s)	255, 266, 369
MspA1I	CMGCKG	1 cut(s)	68
MspR9I	CCNGG	2 cut(s)	43, 161
MvaI	CCWGG	2 cut(s)	43, 161
MwoI	GCNNNNNNNGC	7 cut(s)	91, 130, 247, 421, 424, 427, 430
NlaIII	CATG	3 cut(s)	8, 352, 506
NsiI	ATGCAT	1 cut(s)	6
NspI	RCATGY	2 cut(s)	8, 352
PceI	AGGCCT	1 cut(s)	275
PfoI	TCCNGGA	1 cut(s)	41
PleI	GAGTC	2 cut(s)	176, 514
PpsI	GAGTC	2 cut(s)	176, 514
PshBI	ATTAAT	1 cut(s)	369
Psp6I	CCWGG	2 cut(s)	41, 159
PspFI	CCCAGC	1 cut(s)	354
PspGI	CCWGG	2 cut(s)	41, 159
PspPI	GGNCC	1 cut(s)	289
PstI	CTGCAG	2 cut(s)	135, 316
PvuII	CAGCTG	1 cut(s)	68
SaqAI	TTAA	3 cut(s)	255, 266, 369
Sau96I	GGNCC	1 cut(s)	289
SchI	GAGTC	2 cut(s)	176, 515
ScrFI	CCNGG	2 cut(s)	43, 161
SetI	ASST	7 cut(s)	70, 165, 291, 339, 363, 405, 472
SfaNI	GCATC	4 cut(s)	47, 81, 250, 402
SfcI	CTRYAG	3 cut(s)	131, 312, 389
SinI	GGWCC	1 cut(s)	289
Sse9I	AATT	5 cut(s)	16, 107, 218, 303, 366
SseBI	AGGCCT	1 cut(s)	275
SsiI	CCGC	3 cut(s)	85, 346, 425
StuI	AGGCCT	1 cut(s)	275
StyD4I	CCNGG	2 cut(s)	41, 159
StyI	CCWWGG	2 cut(s)	78, 234
TaaI	ACNGT	1 cut(s)	59
TasI	AATT	5 cut(s)	16, 107, 218, 303, 366
TauI	GCSGC	1 cut(s)	427
Tru1I	TTAA	3 cut(s)	255, 266, 369
Tru9I	TTAA	3 cut(s)	255, 266, 369
VpaK11BI	GGWCC	1 cut(s)	289
VspI	ATTAAT	1 cut(s)	369
XapI	RAATTY	3 cut(s)	16, 218, 303
XceI	RCATGY	2 cut(s)	8, 352
XcmI	CCANNNNNNNNNTGG	1 cut(s)	482
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.