Rmu_sc0003677.1_g000001

OTU domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003677.1
N/A
Physical Location & Seq
Forward (+)
1 .. 910
910 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 517 bp
gttgcttcatctttttcttgcttctgactatgatgtttgctccatctttttcttgcttcagacaaatgctgacaaggatcaggtcaaggctgccattaaggctcaacaagaccaacaaatcgataatgcacttttagctgaggggcgattttactcggatcttgagcttactgagaaagaaattgaacgcatggtgatggaagcttctagggctgagtatcttgcagatggcacattcaagaaacaacttggccgcagagaatcttctacttcaagctgtgagccttcatcttctggagctagatcatcaggcagtgagactaagccagggggtagagaccagggtggccaggattccaccttaagctgtagtatgcaaattgttctgtcgatgggattcagctatctgcaggccatcgaagcttacagcatatttggagatgacgtagattccatggtttgttacttgttggaaactagcagcagtagcaggcgcaaaggcaaggcaacagaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04622 map04622
Pfam Domains
Protein Families
OTU

Protein Analysis

171

Amino Acids

18.77

Weight (kDa)

4.75

Isoelectric Point (pI)

56.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 254
AclWI GGATC 2 cut(s) 85, 166
AcoI YGGCCR 2 cut(s) 251, 347
AcuI CTGAAG 1 cut(s) 42
AflII CTTAAG 1 cut(s) 362
AgsI TTSAA 3 cut(s) 186, 239, 274
AjnI CCWGG 3 cut(s) 326, 340, 349
AluBI AGCT 8 cut(s) 138, 167, 204, 277, 300, 367, 403, 423
AluI AGCT 8 cut(s) 138, 167, 204, 277, 300, 367, 403, 423
Alw26I GTCTC 2 cut(s) 312, 331
AlwI GGATC 2 cut(s) 85, 166
AoxI GGCC 3 cut(s) 251, 347, 412
ApeKI GCWGC 2 cut(s) 90, 481
AspLEI GCGC 1 cut(s) 496
AsuHPI GGTGA 1 cut(s) 206
BalI TGGCCA 1 cut(s) 349
BbvCI CCTCAGC 1 cut(s) 139
BbvI GCAGC 2 cut(s) 77, 493
BccI CCATC 5 cut(s) 51, 191, 222, 386, 423
BciT130I CCWGG 3 cut(s) 328, 342, 351
BcoDI GTCTC 2 cut(s) 312, 331
BfaI CTAG 3 cut(s) 208, 301, 478
BfmI CTRYAG 2 cut(s) 368, 408
BfrI CTTAAG 1 cut(s) 362
BglI GCCNNNNNGGC 1 cut(s) 99
BisI GCNGC 3 cut(s) 91, 254, 482
BlsI GCNGC 3 cut(s) 92, 255, 483
Bme1390I CCNGG 3 cut(s) 328, 342, 351
BmrFI CCNGG 3 cut(s) 328, 342, 351
BpmI CTGGAG 1 cut(s) 316
Bpu10I CCTNAGC 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 183
Bsa29I ATCGAT 1 cut(s) 121
BsaI GGTCTC 1 cut(s) 331
BsaJI CCNNGG 3 cut(s) 327, 341, 454
BsaXI ACNNNNNCTCC 2 cut(s) 430, 460
BseBI CCWGG 3 cut(s) 328, 342, 351
BseCI ATCGAT 1 cut(s) 121
BseDI CCNNGG 3 cut(s) 327, 341, 454
BseMII CTCAG 3 cut(s) 130, 163, 205
BseXI GCAGC 2 cut(s) 77, 493
BshFI GGCC 3 cut(s) 253, 349, 414
BshVI ATCGAT 1 cut(s) 121
BsmAI GTCTC 2 cut(s) 312, 331
BsnI GGCC 3 cut(s) 253, 349, 414
Bso31I GGTCTC 1 cut(s) 331
Bsp143I GATC 3 cut(s) 77, 158, 303
Bsp19I CCATGG 1 cut(s) 454
BspACI CCGC 1 cut(s) 254
BspANI GGCC 3 cut(s) 253, 349, 414
BspCNI CTCAG 3 cut(s) 131, 164, 206
BspDI ATCGAT 1 cut(s) 121
BspMAI CTGCAG 1 cut(s) 412
BspPI GGATC 2 cut(s) 85, 166
BspTI CTTAAG 1 cut(s) 362
BspTNI GGTCTC 1 cut(s) 331
BssECI CCNNGG 3 cut(s) 327, 341, 454
BssMI GATC 3 cut(s) 77, 158, 303
BssT1I CCWWGG 1 cut(s) 454
Bst2UI CCWGG 3 cut(s) 328, 342, 351
BstAFI CTTAAG 1 cut(s) 362
BstC8I GCNNGC 2 cut(s) 412, 492
BstDEI CTNAG 4 cut(s) 139, 172, 214, 322
BstDSI CCRYGG 1 cut(s) 454
BstHHI GCGC 1 cut(s) 496
BstKTI GATC 3 cut(s) 80, 161, 306
BstMAI GTCTC 2 cut(s) 312, 331
BstMBI GATC 3 cut(s) 77, 158, 303
BstMWI GCNNNNNNNGC 5 cut(s) 99, 135, 210, 420, 487
BstNI CCWGG 3 cut(s) 328, 342, 351
BstSCI CCNGG 3 cut(s) 326, 340, 349
BstSFI CTRYAG 2 cut(s) 368, 408
BstV1I GCAGC 2 cut(s) 77, 493
BstX2I RGATCY 1 cut(s) 158
BstYI RGATCY 1 cut(s) 158
Bsu15I ATCGAT 1 cut(s) 121
BsuRI GGCC 3 cut(s) 253, 349, 414
BsuTUI ATCGAT 1 cut(s) 121
BtgI CCRYGG 1 cut(s) 454
BtsI GCAGTG 1 cut(s) 320
BtsIMutI CAGTG 1 cut(s) 320
Cac8I GCNNGC 2 cut(s) 412, 492
CfoI GCGC 1 cut(s) 496
ClaI ATCGAT 1 cut(s) 121
CviAII CATG 2 cut(s) 191, 455
DdeI CTNAG 4 cut(s) 139, 172, 214, 322
DpnI GATC 3 cut(s) 79, 160, 305
DpnII GATC 3 cut(s) 77, 158, 303
EaeI YGGCCR 2 cut(s) 251, 347
Eco130I CCWWGG 1 cut(s) 454
Eco31I GGTCTC 1 cut(s) 331
Eco57I CTGAAG 1 cut(s) 42
EcoRII CCWGG 3 cut(s) 326, 340, 349
EcoT14I CCWWGG 1 cut(s) 454
ErhI CCWWGG 1 cut(s) 454
FaeI CATG 2 cut(s) 194, 458
FaiI YATR 5 cut(s) 31, 192, 375, 432, 456
FatI CATG 2 cut(s) 190, 454
Fnu4HI GCNGC 3 cut(s) 91, 254, 482
Fsp4HI GCNGC 3 cut(s) 91, 254, 482
FspBI CTAG 3 cut(s) 208, 301, 478
GlaI GCGC 1 cut(s) 495
GluI GCNGC 3 cut(s) 91, 254, 482
GsuI CTGGAG 1 cut(s) 316
HaeIII GGCC 3 cut(s) 253, 349, 414
HhaI GCGC 1 cut(s) 496
Hin1II CATG 2 cut(s) 194, 458
Hin6I GCGC 1 cut(s) 494
HinP1I GCGC 1 cut(s) 494
HindIII AAGCTT 2 cut(s) 202, 421
HinfI GANTC 4 cut(s) 261, 354, 397, 450
HphI GGTGA 1 cut(s) 206
Hpy188I TCNGA 3 cut(s) 26, 61, 158
Hpy188III TCNNGA 3 cut(s) 162, 239, 295
HpyAV CCTTC 1 cut(s) 295
HpyCH4IV ACGT 1 cut(s) 445
HpyCH4V TGCA 4 cut(s) 129, 225, 377, 410
HpyF10VI GCNNNNNNNGC 5 cut(s) 99, 135, 210, 420, 487
HpyF3I CTNAG 4 cut(s) 139, 172, 214, 322
HpySE526I ACGT 1 cut(s) 445
Hsp92II CATG 2 cut(s) 194, 458
HspAI GCGC 1 cut(s) 494
Kzo9I GATC 3 cut(s) 77, 158, 303
LmnI GCTCC 2 cut(s) 45, 297
Lsp1109I GCAGC 2 cut(s) 77, 493
MaeI CTAG 3 cut(s) 208, 301, 478
MaeII ACGT 1 cut(s) 445
MaeIII GTNAC 1 cut(s) 462
MalI GATC 3 cut(s) 79, 160, 305
MboI GATC 3 cut(s) 77, 158, 303
MboII GAAGA 2 cut(s) 256, 283
MflI RGATCY 1 cut(s) 158
MlsI TGGCCA 1 cut(s) 349
MluCI AATT 2 cut(s) 181, 379
MluNI TGGCCA 1 cut(s) 349
MmeI TCCRAC 1 cut(s) 451
MnlI CCTC 1 cut(s) 134
Mox20I TGGCCA 1 cut(s) 349
MscI TGGCCA 1 cut(s) 349
MseI TTAA 2 cut(s) 97, 363
MslI CAYNNNNRTG 1 cut(s) 195
Msp20I TGGCCA 1 cut(s) 349
MspCI CTTAAG 1 cut(s) 362
MspR9I CCNGG 3 cut(s) 328, 342, 351
MvaI CCWGG 3 cut(s) 328, 342, 351
MwoI GCNNNNNNNGC 5 cut(s) 99, 135, 210, 420, 487
NcoI CCATGG 1 cut(s) 454
NdeII GATC 3 cut(s) 77, 158, 303
NlaIII CATG 2 cut(s) 194, 458
PfeI GAWTC 4 cut(s) 261, 354, 397, 450
PkrI GCNGC 3 cut(s) 92, 255, 483
Psp6I CCWGG 3 cut(s) 326, 340, 349
PspGI CCWGG 3 cut(s) 326, 340, 349
PstI CTGCAG 1 cut(s) 412
PsuI RGATCY 1 cut(s) 158
RseI CAYNNNNRTG 1 cut(s) 195
SaqAI TTAA 2 cut(s) 97, 363
SatI GCNGC 3 cut(s) 91, 254, 482
Sau3AI GATC 3 cut(s) 77, 158, 303
ScrFI CCNGG 3 cut(s) 328, 342, 351
SfcI CTRYAG 2 cut(s) 368, 408
SmiMI CAYNNNNRTG 1 cut(s) 195
SmlI CTYRAG 2 cut(s) 162, 362
SmoI CTYRAG 2 cut(s) 162, 362
Sse9I AATT 2 cut(s) 181, 379
SsiI CCGC 1 cut(s) 254
SspMI CTAG 3 cut(s) 208, 301, 478
StyD4I CCNGG 3 cut(s) 326, 340, 349
StyI CCWWGG 1 cut(s) 454
TaiI ACGT 1 cut(s) 448
TaqI TCGA 3 cut(s) 121, 390, 418
TasI AATT 2 cut(s) 181, 379
TauI GCSGC 1 cut(s) 256
TfiI GAWTC 4 cut(s) 261, 354, 397, 450
Tru1I TTAA 2 cut(s) 97, 363
Tru9I TTAA 2 cut(s) 97, 363
TscAI CASTG 1 cut(s) 320
TseI GCWGC 2 cut(s) 90, 481
TspDTI ATGAA 1 cut(s) 277
TspRI CASTG 1 cut(s) 320
Vha464I CTTAAG 1 cut(s) 362
XspI CTAG 3 cut(s) 208, 301, 478
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.