Rmu_sc0003715.1_g000002

COBRA-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003715.1
N/A
Physical Location & Seq
Reverse (-)
6894 .. 7490
597 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 597 bp
atgtttctacctcctgaagctcttcttgtaccatttgaaaataggtcagccatggcagaatcttgggcgaaaatcaagcattttcataagcccaagccactaccttgtggtgacaattgtggagttagcatcaattggcatgtgctatcagattacaatgatggatggacagctagaatcacattgttcaattggatgccaatgaatttcgaagattggtttaccgcagtcgaaatgaagaagggtggtggacgtggctttgaaaatgcttactctatgaatgggaccaaaatttctaatatgaataacatcatcttcctccaaggtttaaagggcatgaattttttggtgatgcagacaaatggaacaaagcctaatagtcccaaggttcctggaaagcagcagtctgtgatttcttttaaaaagtctcgtacaccgggcatagaagtagccaaaggggatggctttcctgcaaaagtgtttttcaatggggaagaatgttcgcttcctacttcaattccatcatatggaaaccagaatcatgtaaatttggtagttgtatttttcctttcaattttgagtacttttgctatgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
COBRA

Protein Analysis

198

Amino Acids

22.09

Weight (kDa)

9.15

Isoelectric Point (pI)

33.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
COB_C PF25079 1 - 174 1.4e-73 COBRA family C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 527
AciI CCGC 1 cut(s) 225
AcsI RAATTY 4 cut(s) 205, 291, 340, 547
AcuI CTGAAG 1 cut(s) 36
AfaI GTAC 3 cut(s) 30, 433, 583
AfiI CCNNNNNNNGG 1 cut(s) 527
AgsI TTSAA 6 cut(s) 38, 190, 263, 487, 516, 573
AjiI CACGTC 1 cut(s) 254
AjnI CCWGG 1 cut(s) 391
AluBI AGCT 2 cut(s) 20, 173
AluI AGCT 2 cut(s) 20, 173
Alw26I GTCTC 1 cut(s) 432
ApeKI GCWGC 1 cut(s) 400
ApoI RAATTY 4 cut(s) 205, 291, 340, 547
Asp700I GAANNNNTTC 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 285
AsuC2I CCSGG 1 cut(s) 438
AsuHPI GGTGA 2 cut(s) 122, 361
AsuII TTCGAA 1 cut(s) 210
AvaII GGWCC 1 cut(s) 285
BbvI GCAGC 1 cut(s) 412
BccI CCATC 4 cut(s) 155, 159, 455, 529
BciT130I CCWGG 1 cut(s) 393
BcnI CCSGG 1 cut(s) 438
BcoDI GTCTC 1 cut(s) 432
BfaI CTAG 1 cut(s) 174
BisI GCNGC 1 cut(s) 401
BlsI GCNGC 1 cut(s) 402
BmcAI AGTACT 1 cut(s) 583
Bme1390I CCNGG 2 cut(s) 393, 438
Bme18I GGWCC 1 cut(s) 285
BmgBI CACGTC 1 cut(s) 254
BmgT120I GGNCC 1 cut(s) 285
BmiI GGNNCC 2 cut(s) 286, 390
BmrFI CCNGG 2 cut(s) 393, 438
BmsI GCATC 3 cut(s) 138, 186, 342
Bpu14I TTCGAA 1 cut(s) 210
BpuMI CCSGG 1 cut(s) 438
BsaJI CCNNGG 3 cut(s) 51, 322, 384
Bsc4I CCNNNNNNNGG 1 cut(s) 527
BseBI CCWGG 1 cut(s) 393
BseDI CCNNGG 3 cut(s) 51, 322, 384
BseGI GGATG 3 cut(s) 170, 201, 466
BseLI CCNNNNNNNGG 1 cut(s) 527
BseXI GCAGC 1 cut(s) 412
BsiSI CCGG 1 cut(s) 437
BslFI GGGAC 2 cut(s) 298, 366
BslI CCNNNNNNNGG 1 cut(s) 527
BsmAI GTCTC 1 cut(s) 432
BsmFI GGGAC 2 cut(s) 298, 366
Bsp119I TTCGAA 1 cut(s) 210
Bsp19I CCATGG 1 cut(s) 51
BspACI CCGC 1 cut(s) 225
BspLI GGNNCC 2 cut(s) 286, 390
BspQI GCTCTTC 1 cut(s) 27
BspT104I TTCGAA 1 cut(s) 210
BssECI CCNNGG 3 cut(s) 51, 322, 384
BssT1I CCWWGG 3 cut(s) 51, 322, 384
Bst2UI CCWGG 1 cut(s) 393
Bst6I CTCTTC 1 cut(s) 27
BstBI TTCGAA 1 cut(s) 210
BstDSI CCRYGG 1 cut(s) 51
BstF5I GGATG 3 cut(s) 170, 201, 466
BstMAI GTCTC 1 cut(s) 432
BstNI CCWGG 1 cut(s) 393
BstNSI RCATGY 1 cut(s) 143
BstSCI CCNGG 2 cut(s) 391, 436
BstV1I GCAGC 1 cut(s) 412
BtgI CCRYGG 1 cut(s) 51
BtrI CACGTC 1 cut(s) 254
BtsCI GGATG 3 cut(s) 170, 201, 466
Cfr13I GGNCC 1 cut(s) 285
Csp6I GTAC 3 cut(s) 29, 432, 582
CviAII CATG 4 cut(s) 52, 140, 337, 542
CviJI RGCY 9 cut(s) 20, 50, 91, 97, 173, 258, 373, 452, 465
CviKI_1 RGCY 9 cut(s) 20, 50, 91, 97, 173, 258, 373, 452, 465
CviQI GTAC 3 cut(s) 29, 432, 582
DraI TTTAAA 2 cut(s) 330, 421
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
Eco130I CCWWGG 3 cut(s) 51, 322, 384
Eco47I GGWCC 1 cut(s) 285
Eco57I CTGAAG 1 cut(s) 36
EcoRII CCWGG 1 cut(s) 391
EcoT14I CCWWGG 3 cut(s) 51, 322, 384
ErhI CCWWGG 3 cut(s) 51, 322, 384
FaeI CATG 4 cut(s) 55, 143, 340, 545
FalI AAGNNNNNCTT 2 cut(s) 9, 41
FaqI GGGAC 2 cut(s) 298, 366
FatI CATG 4 cut(s) 51, 139, 336, 541
FauNDI CATATG 1 cut(s) 526
Fnu4HI GCNGC 1 cut(s) 401
FokI GGATG 3 cut(s) 177, 208, 473
Fsp4HI GCNGC 1 cut(s) 401
FspBI CTAG 1 cut(s) 174
GluI GCNGC 1 cut(s) 401
HapII CCGG 1 cut(s) 437
Hin1II CATG 4 cut(s) 55, 143, 340, 545
HinfI GANTC 3 cut(s) 59, 177, 538
HpaII CCGG 1 cut(s) 437
HphI GGTGA 2 cut(s) 122, 361
Hpy166II GTNNAC 3 cut(s) 222, 251, 434
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 14
Hpy8I GTNNAC 3 cut(s) 222, 251, 434
HpyAV CCTTC 1 cut(s) 235
HpyCH4IV ACGT 1 cut(s) 253
HpyCH4V TGCA 2 cut(s) 355, 473
HpySE526I ACGT 1 cut(s) 253
Hsp92II CATG 4 cut(s) 55, 143, 340, 545
LguI GCTCTTC 1 cut(s) 27
LpnPI CCDG 6 cut(s) 27, 378, 405, 450, 483, 548
Lsp1109I GCAGC 1 cut(s) 412
LweI GCATC 3 cut(s) 138, 186, 342
MaeI CTAG 1 cut(s) 174
MaeII ACGT 1 cut(s) 253
MaeIII GTNAC 1 cut(s) 110
MboII GAAGA 5 cut(s) 14, 224, 250, 307, 506
MfeI CAATTG 3 cut(s) 115, 133, 190
MluCI AATT 9 cut(s) 115, 133, 190, 205, 291, 340, 516, 547, 573
MnlI CCTC 2 cut(s) 21, 329
MroXI GAANNNNTTC 1 cut(s) 21
MseI TTAA 2 cut(s) 329, 420
MspI CCGG 1 cut(s) 437
MspR9I CCNGG 2 cut(s) 393, 438
MunI CAATTG 3 cut(s) 115, 133, 190
MvaI CCWGG 1 cut(s) 393
NciI CCSGG 1 cut(s) 438
NcoI CCATGG 1 cut(s) 51
NdeI CATATG 1 cut(s) 526
NlaIII CATG 4 cut(s) 55, 143, 340, 545
NlaIV GGNNCC 2 cut(s) 286, 390
NmuCI GTSAC 1 cut(s) 110
NspI RCATGY 1 cut(s) 143
NspV TTCGAA 1 cut(s) 210
PciSI GCTCTTC 1 cut(s) 27
PdmI GAANNNNTTC 1 cut(s) 21
PfeI GAWTC 3 cut(s) 59, 177, 538
PflMI CCANNNNNTGG 1 cut(s) 527
PfoI TCCNGGA 1 cut(s) 391
PkrI GCNGC 1 cut(s) 402
Psp6I CCWGG 1 cut(s) 391
PspGI CCWGG 1 cut(s) 391
PspN4I GGNNCC 2 cut(s) 286, 390
PspPI GGNCC 1 cut(s) 285
RsaI GTAC 3 cut(s) 30, 433, 583
RsaNI GTAC 3 cut(s) 29, 432, 582
SapI GCTCTTC 1 cut(s) 27
SaqAI TTAA 2 cut(s) 329, 420
SatI GCNGC 1 cut(s) 401
Sau96I GGNCC 1 cut(s) 285
ScaI AGTACT 1 cut(s) 583
ScrFI CCNGG 2 cut(s) 393, 438
SetI ASST 8 cut(s) 13, 22, 47, 106, 175, 256, 328, 390
SfaNI GCATC 3 cut(s) 138, 186, 342
SfuI TTCGAA 1 cut(s) 210
SinI GGWCC 1 cut(s) 285
Sse9I AATT 9 cut(s) 115, 133, 190, 205, 291, 340, 516, 547, 573
SsiI CCGC 1 cut(s) 225
SspMI CTAG 1 cut(s) 174
StyD4I CCNGG 2 cut(s) 391, 436
StyI CCWWGG 3 cut(s) 51, 322, 384
TaiI ACGT 1 cut(s) 256
TaqI TCGA 2 cut(s) 210, 231
TasI AATT 9 cut(s) 115, 133, 190, 205, 291, 340, 516, 547, 573
TatI WGTACW 1 cut(s) 581
TfiI GAWTC 3 cut(s) 59, 177, 538
Tru1I TTAA 2 cut(s) 329, 420
Tru9I TTAA 2 cut(s) 329, 420
TseFI GTSAC 1 cut(s) 110
TseI GCWGC 1 cut(s) 400
Tsp45I GTSAC 1 cut(s) 110
TspDTI ATGAA 6 cut(s) 74, 218, 251, 293, 317, 353
Van91I CCANNNNNTGG 1 cut(s) 527
VpaK11BI GGWCC 1 cut(s) 285
XapI RAATTY 4 cut(s) 205, 291, 340, 547
XceI RCATGY 1 cut(s) 143
XmnI GAANNNNTTC 1 cut(s) 21
XspI CTAG 1 cut(s) 174
ZrmI AGTACT 1 cut(s) 583
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.