Rmu_sc0003747.1_g000002

Cytochrome c biogenesis protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003747.1
N/A
Physical Location & Seq
Forward (+)
25242 .. 26168
927 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 393 bp
atgcttttgcgagatctacaatcaattgtcctgtatgatcaagaagggaaatttgttggagttcgacgaccaagttccaagcttccaattgaaatcgatggctccaaaattactattgtagatgcaattgggagtagcggtcttgccctgaagactgacccgggagtgccagttgtatatgctggattcggtgctctaatgctcacaacttgcatcagttttctatctcattcacagatatgggccttacaagatggaacagcagtggtcgtaggaggaaaaactaatcgagcaaagggtgaatttccggaagagatgaatcgcttgcttgatcgggttcctgaattgattgattcatctctttccaagcaatctgatagcactagtggctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ResB

Protein Analysis

130

Amino Acids

13.91

Weight (kDa)

5.32

Isoelectric Point (pI)

53.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ResB PF05140 17 - 106 3.4e-11 ResB-like family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 307
AciI CCGC 1 cut(s) 138
AcsI RAATTY 2 cut(s) 50, 302
AcuI CTGAAG 1 cut(s) 170
AgsI TTSAA 1 cut(s) 92
AhlI ACTAGT 1 cut(s) 383
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
Alw21I GWGCWC 1 cut(s) 196
Ama87I CYCGRG 1 cut(s) 160
Aor13HI TCCGGA 1 cut(s) 307
AoxI GGCC 1 cut(s) 243
ApoI RAATTY 2 cut(s) 50, 302
AspS9I GGNCC 1 cut(s) 243
AsuC2I CCSGG 2 cut(s) 161, 162
AsuHPI GGTGA 1 cut(s) 311
AvaI CYCGRG 1 cut(s) 160
BbsI GAAGAC 1 cut(s) 158
Bbv12I GWGCWC 1 cut(s) 196
BccI CCATC 2 cut(s) 92, 248
BclI TGATCA 1 cut(s) 37
BcnI CCSGG 2 cut(s) 161, 162
BcuI ACTAGT 1 cut(s) 383
BfaI CTAG 2 cut(s) 384, 391
BglII AGATCT 1 cut(s) 13
Bme1390I CCNGG 2 cut(s) 161, 162
BmeT110I CYCGRG 1 cut(s) 160
BmgT120I GGNCC 1 cut(s) 243
BmiI GGNNCC 2 cut(s) 103, 339
BmrFI CCNGG 2 cut(s) 161, 162
BmsI GCATC 2 cut(s) 112, 222
BpiI GAAGAC 1 cut(s) 158
BpuMI CCSGG 2 cut(s) 161, 162
Bsa29I ATCGAT 1 cut(s) 96
BsaJI CCNNGG 1 cut(s) 160
BsaWI WCCGGW 1 cut(s) 307
BsaXI ACNNNNNCTCC 4 cut(s) 124, 154, 156, 186
Bse1I ACTGG 1 cut(s) 170
BseAI TCCGGA 1 cut(s) 307
BseCI ATCGAT 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 160
BseNI ACTGG 1 cut(s) 170
BshFI GGCC 1 cut(s) 245
BshVI ATCGAT 1 cut(s) 96
BsiHKAI GWGCWC 1 cut(s) 196
BsiHKCI CYCGRG 1 cut(s) 160
BsiSI CCGG 2 cut(s) 161, 308
BsnI GGCC 1 cut(s) 245
BsoBI CYCGRG 1 cut(s) 160
Bsp1286I GDGCHC 1 cut(s) 196
Bsp13I TCCGGA 1 cut(s) 307
Bsp143I GATC 3 cut(s) 13, 37, 331
BspACI CCGC 1 cut(s) 138
BspANI GGCC 1 cut(s) 245
BspDI ATCGAT 1 cut(s) 96
BspEI TCCGGA 1 cut(s) 307
BspLI GGNNCC 2 cut(s) 103, 339
BsrI ACTGG 1 cut(s) 170
BssECI CCNNGG 1 cut(s) 160
BssMI GATC 3 cut(s) 13, 37, 331
Bst6I CTCTTC 1 cut(s) 306
BstC8I GCNNGC 1 cut(s) 326
BstKTI GATC 3 cut(s) 16, 40, 334
BstMBI GATC 3 cut(s) 13, 37, 331
BstMWI GCNNNNNNNGC 1 cut(s) 387
BstSCI CCNGG 2 cut(s) 159, 160
BstV2I GAAGAC 1 cut(s) 158
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
Bsu15I ATCGAT 1 cut(s) 96
BsuRI GGCC 1 cut(s) 245
BsuTUI ATCGAT 1 cut(s) 96
BtsI GCAGTG 1 cut(s) 270
BtsIMutI CAGTG 1 cut(s) 270
Cac8I GCNNGC 1 cut(s) 326
Cfr13I GGNCC 1 cut(s) 243
Cfr9I CCCGGG 1 cut(s) 160
ClaI ATCGAT 1 cut(s) 96
CviJI RGCY 4 cut(s) 82, 102, 245, 390
CviKI_1 RGCY 4 cut(s) 82, 102, 245, 390
DpnI GATC 3 cut(s) 15, 39, 333
DpnII GATC 3 cut(s) 13, 37, 331
Eam1104I CTCTTC 1 cut(s) 306
EarI CTCTTC 1 cut(s) 306
Eco57I CTGAAG 1 cut(s) 170
Eco88I CYCGRG 1 cut(s) 160
FaiI YATR 4 cut(s) 36, 178, 180, 241
FbaI TGATCA 1 cut(s) 37
FspBI CTAG 2 cut(s) 384, 391
HaeIII GGCC 1 cut(s) 245
HapII CCGG 2 cut(s) 161, 308
HindIII AAGCTT 1 cut(s) 80
HinfI GANTC 3 cut(s) 186, 319, 353
HpaII CCGG 2 cut(s) 161, 308
HphI GGTGA 1 cut(s) 311
Hpy188I TCNGA 1 cut(s) 376
Hpy188III TCNNGA 3 cut(s) 41, 308, 341
Hpy99I CGWCG 1 cut(s) 69
HpyAV CCTTC 1 cut(s) 38
HpyCH4V TGCA 2 cut(s) 125, 213
HpyF10VI GCNNNNNNNGC 1 cut(s) 387
Kpn2I TCCGGA 1 cut(s) 307
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 3 cut(s) 13, 37, 331
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 7 cut(s) 44, 161, 168, 174, 183, 321, 354
LweI GCATC 2 cut(s) 112, 222
MaeI CTAG 2 cut(s) 384, 391
MalI GATC 3 cut(s) 15, 39, 333
MboI GATC 3 cut(s) 13, 37, 331
MboII GAAGA 2 cut(s) 163, 323
MfeI CAATTG 3 cut(s) 24, 87, 126
MflI RGATCY 1 cut(s) 13
MhlI GDGCHC 1 cut(s) 196
MluCI AATT 7 cut(s) 24, 50, 87, 108, 126, 302, 344
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 1 cut(s) 269
MroI TCCGGA 1 cut(s) 307
MslI CAYNNNNRTG 1 cut(s) 238
MspI CCGG 2 cut(s) 161, 308
MspR9I CCNGG 2 cut(s) 161, 162
MunI CAATTG 3 cut(s) 24, 87, 126
MwoI GCNNNNNNNGC 1 cut(s) 387
NciI CCSGG 2 cut(s) 161, 162
NdeII GATC 3 cut(s) 13, 37, 331
NlaIV GGNNCC 2 cut(s) 103, 339
PfeI GAWTC 3 cut(s) 186, 319, 353
PspN4I GGNNCC 2 cut(s) 103, 339
PspPI GGNCC 1 cut(s) 243
PsuI RGATCY 1 cut(s) 13
RseI CAYNNNNRTG 1 cut(s) 238
Sau3AI GATC 3 cut(s) 13, 37, 331
Sau96I GGNCC 1 cut(s) 243
ScrFI CCNGG 2 cut(s) 161, 162
SduI GDGCHC 1 cut(s) 196
SetI ASST 1 cut(s) 84
SfaNI GCATC 2 cut(s) 112, 222
SmaI CCCGGG 1 cut(s) 162
SmiMI CAYNNNNRTG 1 cut(s) 238
SpeI ACTAGT 1 cut(s) 383
Sse9I AATT 7 cut(s) 24, 50, 87, 108, 126, 302, 344
SsiI CCGC 1 cut(s) 138
SspMI CTAG 2 cut(s) 384, 391
StyD4I CCNGG 2 cut(s) 159, 160
TaqI TCGA 3 cut(s) 64, 96, 289
TasI AATT 7 cut(s) 24, 50, 87, 108, 126, 302, 344
TfiI GAWTC 3 cut(s) 186, 319, 353
TscAI CASTG 1 cut(s) 270
TspDTI ATGAA 2 cut(s) 332, 345
TspMI CCCGGG 1 cut(s) 160
TspRI CASTG 1 cut(s) 270
XapI RAATTY 2 cut(s) 50, 302
XmaI CCCGGG 1 cut(s) 160
XspI CTAG 2 cut(s) 384, 391
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.