Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003812.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 547

Gene Structure 547 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 547 bp

ggtttatggtcttttggcgagaaggagagtaaatgaagcttatgggattgtggaagggattgagaagccggatatcagtgtgtaccatggcttgatgaaggggctgttgaggttaaagaggccgggggaagcgacacgagtgtttagggagatgatcaagagggggtgtgagcctaacatgcacacatatgtcatgttattgcaagggcatttgggaaagagagggaggaagggaaaggatccgcttgtgaatttcgacaccatttttgttgggggtttggttaaggcagggaagtcattggaagccaccaagtatgtggagagagcgactaaaagagggcttgaggtgcctagattcgattataacaagtttttgcattactactcgaacgaggaaggggtggcaatgtttgaggaggtggggaagaaattaagggaggccggaatggttgatttggcggatattttccagagatatggggagaaaatggcgacaagagatagaagaagagatagagctgtcgagccattagtagagcgttcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_1 PPR_2

Protein Analysis

181

Amino Acids

20.82

Weight (kDa)

9.78

Isoelectric Point (pI)

41.59

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PPR_2	PF13041	23 - 70	5.3e-12	PPR repeat family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	364
AccB1I	GGYRCC	1 cut(s)	347
AciI	CCGC	2 cut(s)	243, 459
AclWI	GGATC	2 cut(s)	234, 247
AcsI	RAATTY	1 cut(s)	251
AfaI	GTAC	1 cut(s)	84
AluBI	AGCT	2 cut(s)	39, 519
AluI	AGCT	2 cut(s)	39, 519
AlwI	GGATC	2 cut(s)	234, 247
AoxI	GGCC	2 cut(s)	120, 439
ApoI	RAATTY	1 cut(s)	251
ArsI	GACNNNNNNTTYG	2 cut(s)	249, 281
AsuC2I	CCSGG	1 cut(s)	124
BamHI	GGATCC	1 cut(s)	239
BanI	GGYRCC	1 cut(s)	347
BauI	CACGAG	1 cut(s)	136
BclI	TGATCA	1 cut(s)	154
BcnI	CCSGG	1 cut(s)	124
BfaI	CTAG	1 cut(s)	352
Bme1390I	CCNGG	1 cut(s)	124
BmiI	GGNNCC	2 cut(s)	241, 349
BmrFI	CCNGG	1 cut(s)	124
BpuEI	CTTGAG	1 cut(s)	363
BpuMI	CCSGG	1 cut(s)	124
BsaJI	CCNNGG	2 cut(s)	86, 123
Bse3DI	GCAATG	1 cut(s)	412
BseDI	CCNNGG	2 cut(s)	86, 123
BseMI	GCAATG	1 cut(s)	412
BseRI	GAGGAG	1 cut(s)	429
BshFI	GGCC	2 cut(s)	122, 441
BshNI	GGYRCC	1 cut(s)	347
BsiSI	CCGG	3 cut(s)	69, 123, 442
BsnI	GGCC	2 cut(s)	122, 441
Bsp143I	GATC	2 cut(s)	154, 239
Bsp19I	CCATGG	1 cut(s)	86
BspACI	CCGC	2 cut(s)	243, 459
BspANI	GGCC	2 cut(s)	122, 441
BspLI	GGNNCC	2 cut(s)	241, 349
BspPI	GGATC	2 cut(s)	234, 247
BspT107I	GGYRCC	1 cut(s)	347
BsrDI	GCAATG	1 cut(s)	412
BssECI	CCNNGG	2 cut(s)	86, 123
BssMI	GATC	2 cut(s)	154, 239
BssSI	CACGAG	1 cut(s)	136
BssT1I	CCWWGG	1 cut(s)	86
Bst2BI	CACGAG	1 cut(s)	136
Bst6I	CTCTTC	1 cut(s)	503
BstDSI	CCRYGG	1 cut(s)	86
BstKTI	GATC	2 cut(s)	157, 242
BstMBI	GATC	2 cut(s)	154, 239
BstMWI	GCNNNNNNNGC	2 cut(s)	179, 347
BstNSI	RCATGY	1 cut(s)	182
BstSCI	CCNGG	1 cut(s)	122
BstX2I	RGATCY	1 cut(s)	239
BstXI	CCANNNNNNTGG	2 cut(s)	317, 477
BstYI	RGATCY	1 cut(s)	239
BsuRI	GGCC	2 cut(s)	122, 441
BtgI	CCRYGG	1 cut(s)	86
BtsIMutI	CAGTG	1 cut(s)	83
Csp6I	GTAC	1 cut(s)	83
CviAII	CATG	3 cut(s)	87, 179, 194
CviQI	GTAC	1 cut(s)	83
DpnI	GATC	2 cut(s)	156, 241
DpnII	GATC	2 cut(s)	154, 239
Eam1104I	CTCTTC	1 cut(s)	503
EarI	CTCTTC	1 cut(s)	503
EciI	GGCGGA	1 cut(s)	474
Eco130I	CCWWGG	1 cut(s)	86
Eco32I	GATATC	1 cut(s)	74
EcoRV	GATATC	1 cut(s)	74
EcoT14I	CCWWGG	1 cut(s)	86
ErhI	CCWWGG	1 cut(s)	86
FaeI	CATG	3 cut(s)	90, 182, 197
FatI	CATG	3 cut(s)	86, 178, 193
FauNDI	CATATG	1 cut(s)	188
FbaI	TGATCA	1 cut(s)	154
FspBI	CTAG	1 cut(s)	352
HaeIII	GGCC	2 cut(s)	122, 441
HapII	CCGG	3 cut(s)	69, 123, 442
Hin1II	CATG	3 cut(s)	90, 182, 197
HindIII	AAGCTT	1 cut(s)	37
HinfI	GANTC	1 cut(s)	355
HpaII	CCGG	3 cut(s)	69, 123, 442
Hpy166II	GTNNAC	1 cut(s)	83
Hpy188III	TCNNGA	2 cut(s)	158, 470
Hpy8I	GTNNAC	1 cut(s)	83
HpyAV	CCTTC	5 cut(s)	16, 48, 92, 224, 390
HpyCH4V	TGCA	3 cut(s)	182, 203, 377
HpyF10VI	GCNNNNNNNGC	2 cut(s)	179, 347
Hsp92II	CATG	3 cut(s)	90, 182, 197
Ksp22I	TGATCA	1 cut(s)	154
Kzo9I	GATC	2 cut(s)	154, 239
LpnPI	CCDG	5 cut(s)	82, 136, 274, 455, 483
MaeI	CTAG	1 cut(s)	352
MalI	GATC	2 cut(s)	156, 241
MboI	GATC	2 cut(s)	154, 239
MboII	GAAGA	3 cut(s)	437, 517, 520
MflI	RGATCY	1 cut(s)	239
MluCI	AATT	2 cut(s)	251, 429
MseI	TTAA	3 cut(s)	114, 283, 432
MslI	CAYNNNNRTG	1 cut(s)	187
MspI	CCGG	3 cut(s)	69, 123, 442
MspR9I	CCNGG	1 cut(s)	124
MwoI	GCNNNNNNNGC	2 cut(s)	179, 347
NciI	CCSGG	1 cut(s)	124
NcoI	CCATGG	1 cut(s)	86
NdeI	CATATG	1 cut(s)	188
NdeII	GATC	2 cut(s)	154, 239
NlaIII	CATG	3 cut(s)	90, 182, 197
NlaIV	GGNNCC	2 cut(s)	241, 349
NspI	RCATGY	1 cut(s)	182
PfeI	GAWTC	1 cut(s)	355
PsiI	TTATAA	1 cut(s)	364
PspN4I	GGNNCC	2 cut(s)	241, 349
PsuI	RGATCY	1 cut(s)	239
RsaI	GTAC	1 cut(s)	84
RsaNI	GTAC	1 cut(s)	83
RseI	CAYNNNNRTG	1 cut(s)	187
SaqAI	TTAA	3 cut(s)	114, 283, 432
Sau3AI	GATC	2 cut(s)	154, 239
ScrFI	CCNGG	1 cut(s)	124
SetI	ASST	5 cut(s)	41, 114, 349, 421, 521
SmiMI	CAYNNNNRTG	1 cut(s)	187
SmlI	CTYRAG	1 cut(s)	342
SmoI	CTYRAG	1 cut(s)	342
Sse9I	AATT	2 cut(s)	251, 429
SsiI	CCGC	2 cut(s)	243, 459
SspMI	CTAG	1 cut(s)	352
StyD4I	CCNGG	1 cut(s)	122
StyI	CCWWGG	1 cut(s)	86
TaqI	TCGA	4 cut(s)	256, 358, 387, 523
TasI	AATT	2 cut(s)	251, 429
TfiI	GAWTC	1 cut(s)	355
Tru1I	TTAA	3 cut(s)	114, 283, 432
Tru9I	TTAA	3 cut(s)	114, 283, 432
TscAI	CASTG	1 cut(s)	83
TspDTI	ATGAA	3 cut(s)	49, 111, 532
TspRI	CASTG	1 cut(s)	83
XapI	RAATTY	1 cut(s)	251
XceI	RCATGY	1 cut(s)	182
XcmI	CCANNNNNNNNNTGG	1 cut(s)	314
XspI	CTAG	1 cut(s)	352

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.