Rmu_sc0003813.1_g000013

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003813.1
N/A
Physical Location & Seq
Reverse (-)
60259 .. 60913
655 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 579 bp
atgtgggccaaggacgaggagtgtggtctcttagttcaacaaacacggtctgacggtggagttgtagtcaaggttagaagggtggttgagagattgaaagtgtggggaaaggaaaaatttggcagtgtgcctcggctggtgaatgaattaagacaggagcttgatgatttgcagcgtcaatcaccctcccctgaaatactaaattggctccaacatggggatcgaaatactaatttttccacaactatacaaggcagaggggacgcaccaataaaatctctgctattttgggagaagataatcgatggagaactagctagtatacttgaatacctgatattggctgctattagtgcaagagtttctgaagctcatgtggattctctttctaagagttttacaagggcagaagttgaaagggctcttaaaggaatgggagctacgaaggctccgggaccggatggaatgccacccattttctatcagaagtattggtttgttgtgggttcggaggtggtagcgagatgcttggatttcttactggacaaggctctattgcggagcttaaccaaactttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

192

Amino Acids

21.6

Weight (kDa)

8.53

Isoelectric Point (pI)

43.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 322
AciI CCGC 1 cut(s) 559
AclWI GGATC 1 cut(s) 228
AcsI RAATTY 1 cut(s) 116
AcuI CTGAAG 1 cut(s) 387
AfiI CCNNNNNNNGG 2 cut(s) 217, 340
AgsI TTSAA 4 cut(s) 38, 97, 329, 416
AluBI AGCT 5 cut(s) 160, 317, 371, 440, 564
AluI AGCT 5 cut(s) 160, 317, 371, 440, 564
Alw26I GTCTC 1 cut(s) 32
AlwI GGATC 1 cut(s) 228
AoxI GGCC 1 cut(s) 6
ApeKI GCWGC 2 cut(s) 172, 344
ApoI RAATTY 1 cut(s) 116
AspS9I GGNCC 2 cut(s) 6, 455
AsuC2I CCSGG 1 cut(s) 453
AsuHPI GGTGA 2 cut(s) 151, 174
AvaII GGWCC 1 cut(s) 455
BanII GRGCYC 1 cut(s) 424
BbvI GCAGC 2 cut(s) 184, 331
BccI CCATC 2 cut(s) 299, 455
BcnI CCSGG 1 cut(s) 453
BcoDI GTCTC 1 cut(s) 32
BfaI CTAG 2 cut(s) 314, 318
BisI GCNGC 2 cut(s) 173, 345
BlsI GCNGC 2 cut(s) 174, 346
Bme1390I CCNGG 1 cut(s) 453
Bme18I GGWCC 1 cut(s) 455
BmgT120I GGNCC 2 cut(s) 6, 455
BmiI GGNNCC 3 cut(s) 209, 450, 456
BmrFI CCNGG 1 cut(s) 453
BmsI GCATC 1 cut(s) 515
BpuMI CCSGG 1 cut(s) 453
Bsa29I ATCGAT 1 cut(s) 303
BsaI GGTCTC 1 cut(s) 32
BsaJI CCNNGG 2 cut(s) 9, 131
BsaWI WCCGGW 1 cut(s) 457
BsaXI ACNNNNNCTCC 4 cut(s) 51, 81, 433, 463
Bsc4I CCNNNNNNNGG 2 cut(s) 217, 340
Bse1I ACTGG 1 cut(s) 546
BseCI ATCGAT 1 cut(s) 303
BseDI CCNNGG 2 cut(s) 9, 131
BseGI GGATG 1 cut(s) 466
BseLI CCNNNNNNNGG 2 cut(s) 217, 340
BseNI ACTGG 1 cut(s) 546
BseRI GAGGAG 1 cut(s) 32
BseXI GCAGC 2 cut(s) 184, 331
BshFI GGCC 1 cut(s) 8
BshVI ATCGAT 1 cut(s) 303
BsiSI CCGG 2 cut(s) 452, 458
BslFI GGGAC 2 cut(s) 275, 468
BslI CCNNNNNNNGG 2 cut(s) 217, 340
BsmAI GTCTC 1 cut(s) 32
BsmFI GGGAC 2 cut(s) 275, 468
BsmI GAATGC 1 cut(s) 471
BsnI GGCC 1 cut(s) 8
Bso31I GGTCTC 1 cut(s) 32
Bsp1286I GDGCHC 1 cut(s) 424
Bsp143I GATC 1 cut(s) 220
BspACI CCGC 1 cut(s) 559
BspANI GGCC 1 cut(s) 8
BspDI ATCGAT 1 cut(s) 303
BspLI GGNNCC 3 cut(s) 209, 450, 456
BspPI GGATC 1 cut(s) 228
BspTNI GGTCTC 1 cut(s) 32
BsrI ACTGG 1 cut(s) 546
BssECI CCNNGG 2 cut(s) 9, 131
BssMI GATC 1 cut(s) 220
BssNAI GTATAC 1 cut(s) 323
BssT1I CCWWGG 1 cut(s) 9
Bst1107I GTATAC 1 cut(s) 323
Bst4CI ACNGT 2 cut(s) 48, 56
BstDEI CTNAG 2 cut(s) 31, 390
BstF5I GGATG 1 cut(s) 466
BstKTI GATC 1 cut(s) 223
BstMAI GTCTC 1 cut(s) 32
BstMBI GATC 1 cut(s) 220
BstMWI GCNNNNNNNGC 2 cut(s) 353, 446
BstSCI CCNGG 1 cut(s) 451
BstV1I GCAGC 2 cut(s) 184, 331
BstZ17I GTATAC 1 cut(s) 323
Bsu15I ATCGAT 1 cut(s) 303
BsuRI GGCC 1 cut(s) 8
BsuTUI ATCGAT 1 cut(s) 303
BtsCI GGATG 1 cut(s) 466
BtsI GCAGTG 1 cut(s) 130
BtsIMutI CAGTG 1 cut(s) 130
Cfr13I GGNCC 2 cut(s) 6, 455
ClaI ATCGAT 1 cut(s) 303
CseI GACGC 2 cut(s) 164, 272
CviAII CATG 2 cut(s) 215, 374
DdeI CTNAG 2 cut(s) 31, 390
DpnI GATC 1 cut(s) 222
DpnII GATC 1 cut(s) 220
Eco130I CCWWGG 1 cut(s) 9
Eco24I GRGCYC 1 cut(s) 424
Eco31I GGTCTC 1 cut(s) 32
Eco47I GGWCC 1 cut(s) 455
Eco57I CTGAAG 1 cut(s) 387
EcoT14I CCWWGG 1 cut(s) 9
EcoT38I GRGCYC 1 cut(s) 424
ErhI CCWWGG 1 cut(s) 9
FaeI CATG 2 cut(s) 218, 377
FaiI YATR 4 cut(s) 216, 248, 323, 375
FaqI GGGAC 2 cut(s) 275, 468
FatI CATG 2 cut(s) 214, 373
FblI GTMKAC 1 cut(s) 322
Fnu4HI GCNGC 2 cut(s) 173, 345
FokI GGATG 1 cut(s) 473
FriOI GRGCYC 1 cut(s) 424
Fsp4HI GCNGC 2 cut(s) 173, 345
FspBI CTAG 2 cut(s) 314, 318
GluI GCNGC 2 cut(s) 173, 345
HaeIII GGCC 1 cut(s) 8
HapII CCGG 2 cut(s) 452, 458
HgaI GACGC 2 cut(s) 164, 272
Hin1II CATG 2 cut(s) 218, 377
HinfI GANTC 1 cut(s) 380
HpaII CCGG 2 cut(s) 452, 458
HphI GGTGA 2 cut(s) 151, 174
Hpy166II GTNNAC 1 cut(s) 323
Hpy188I TCNGA 4 cut(s) 52, 367, 486, 511
Hpy8I GTNNAC 1 cut(s) 323
HpyAV CCTTC 2 cut(s) 72, 439
HpyCH4III ACNGT 2 cut(s) 48, 56
HpyCH4V TGCA 2 cut(s) 172, 356
HpyF10VI GCNNNNNNNGC 2 cut(s) 353, 446
HpyF3I CTNAG 2 cut(s) 31, 390
Hsp92II CATG 2 cut(s) 218, 377
Kzo9I GATC 1 cut(s) 220
LmnI GCTCC 5 cut(s) 157, 213, 437, 454, 561
LpnPI CCDG 7 cut(s) 122, 140, 204, 347, 465, 471, 527
Lsp1109I GCAGC 2 cut(s) 184, 331
LweI GCATC 1 cut(s) 515
MaeI CTAG 2 cut(s) 314, 318
MalI GATC 1 cut(s) 222
MboI GATC 1 cut(s) 220
MboII GAAGA 1 cut(s) 307
MhlI GDGCHC 1 cut(s) 424
MluCI AATT 4 cut(s) 116, 146, 202, 232
MmeI TCCRAC 1 cut(s) 235
MnlI CCTC 5 cut(s) 10, 141, 196, 251, 505
MseI TTAA 3 cut(s) 149, 426, 566
MspI CCGG 2 cut(s) 452, 458
MspR9I CCNGG 1 cut(s) 453
Mva1269I GAATGC 1 cut(s) 471
MwoI GCNNNNNNNGC 2 cut(s) 353, 446
NciI CCSGG 1 cut(s) 453
NdeII GATC 1 cut(s) 220
NlaIII CATG 2 cut(s) 218, 377
NlaIV GGNNCC 3 cut(s) 209, 450, 456
NmeAIII GCCGAG 1 cut(s) 112
PctI GAATGC 1 cut(s) 471
PfeI GAWTC 1 cut(s) 380
PfoI TCCNGGA 1 cut(s) 451
PkrI GCNGC 2 cut(s) 174, 346
PspN4I GGNNCC 3 cut(s) 209, 450, 456
PspPI GGNCC 2 cut(s) 6, 455
SaqAI TTAA 3 cut(s) 149, 426, 566
SatI GCNGC 2 cut(s) 173, 345
Sau3AI GATC 1 cut(s) 220
Sau96I GGNCC 2 cut(s) 6, 455
ScrFI CCNGG 1 cut(s) 453
SduI GDGCHC 1 cut(s) 424
SetI ASST 8 cut(s) 75, 162, 319, 336, 373, 442, 516, 566
SfaNI GCATC 1 cut(s) 515
SinI GGWCC 1 cut(s) 455
Sse9I AATT 4 cut(s) 116, 146, 202, 232
SsiI CCGC 1 cut(s) 559
SspMI CTAG 2 cut(s) 314, 318
StyD4I CCNGG 1 cut(s) 451
StyI CCWWGG 1 cut(s) 9
TaaI ACNGT 2 cut(s) 48, 56
TaqI TCGA 2 cut(s) 223, 303
TasI AATT 4 cut(s) 116, 146, 202, 232
TfiI GAWTC 1 cut(s) 380
Tru1I TTAA 3 cut(s) 149, 426, 566
Tru9I TTAA 3 cut(s) 149, 426, 566
TscAI CASTG 1 cut(s) 130
TseI GCWGC 2 cut(s) 172, 344
TspDTI ATGAA 1 cut(s) 159
TspRI CASTG 1 cut(s) 130
VpaK11BI GGWCC 1 cut(s) 455
XapI RAATTY 1 cut(s) 116
XmiI GTMKAC 1 cut(s) 322
XspI CTAG 2 cut(s) 314, 318
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.