Rmu_sc0003819.1_g000009

acyl-CoA-binding protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003819.1
N/A
Physical Location & Seq
Reverse (-)
32006 .. 32617
612 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 324 bp
atgactgcaatgaaaggaactgcaggaagaagaactagactcatgggctcgaccgctcgagaagaactagctgctgtgccgctgtgctgcctgcccaaatctcatctaggctacagtccagatagtcttccacctagatacgccacgggctatacaagcaagcaaccatcggctccgttaatactagttaatcgacctgggttctttagcccaactgagagggccagatgggatgcttggacatcagttgaaggaaagatccaagaagaagcaattgctgaatacattgaaaaggtgaagcagctgctagcagcttccacataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
ACBP

Protein Analysis

107

Amino Acids

11.73

Weight (kDa)

9.3

Isoelectric Point (pI)

57.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ACBP PF00887 64 - 99 1.9e-08 Acyl CoA binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 56
AciI CCGC 2 cut(s) 54, 80
AclWI GGATC 1 cut(s) 253
AgsI TTSAA 2 cut(s) 251, 290
AhlI ACTAGT 1 cut(s) 184
AjnI CCWGG 1 cut(s) 196
AluBI AGCT 3 cut(s) 71, 304, 314
AluI AGCT 3 cut(s) 71, 304, 314
AlwI GGATC 1 cut(s) 253
Ama87I CYCGRG 1 cut(s) 57
AoxI GGCC 1 cut(s) 222
ApeKI GCWGC 5 cut(s) 71, 87, 301, 304, 311
AspS9I GGNCC 1 cut(s) 222
AsuHPI GGTGA 1 cut(s) 307
AsuNHI GCTAGC 1 cut(s) 307
AvaI CYCGRG 1 cut(s) 57
BanII GRGCYC 1 cut(s) 50
BbsI GAAGAC 1 cut(s) 119
BbvI GCAGC 4 cut(s) 58, 74, 291, 313
BccI CCATC 2 cut(s) 175, 222
BciT130I CCWGG 1 cut(s) 198
BcuI ACTAGT 1 cut(s) 184
BfaI CTAG 6 cut(s) 36, 68, 107, 135, 185, 308
BfmI CTRYAG 2 cut(s) 21, 112
BisI GCNGC 6 cut(s) 72, 80, 88, 302, 305, 312
BlsI GCNGC 6 cut(s) 73, 81, 89, 303, 306, 313
Bme1390I CCNGG 1 cut(s) 198
BmeT110I CYCGRG 1 cut(s) 57
BmgT120I GGNCC 1 cut(s) 222
BmiI GGNNCC 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 198
BmsI GCATC 1 cut(s) 223
BmtI GCTAGC 1 cut(s) 311
BpiI GAAGAC 1 cut(s) 119
BsaJI CCNNGG 2 cut(s) 144, 197
Bse3DI GCAATG 1 cut(s) 15
BseBI CCWGG 1 cut(s) 198
BseDI CCNNGG 2 cut(s) 144, 197
BseGI GGATG 1 cut(s) 238
BseMI GCAATG 1 cut(s) 15
BseMII CTCAG 1 cut(s) 207
BseXI GCAGC 4 cut(s) 58, 74, 291, 313
Bsh1285I CGRYCG 1 cut(s) 54
BshFI GGCC 1 cut(s) 224
BsiEI CGRYCG 1 cut(s) 54
BsiHKCI CYCGRG 1 cut(s) 57
BsnI GGCC 1 cut(s) 224
BsoBI CYCGRG 1 cut(s) 57
Bsp1286I GDGCHC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 258
BspACI CCGC 2 cut(s) 54, 80
BspANI GGCC 1 cut(s) 224
BspCNI CTCAG 1 cut(s) 208
BspLI GGNNCC 1 cut(s) 174
BspMAI CTGCAG 1 cut(s) 25
BspOI GCTAGC 1 cut(s) 311
BspPI GGATC 1 cut(s) 253
BsrBI CCGCTC 1 cut(s) 56
BsrDI GCAATG 1 cut(s) 15
BssECI CCNNGG 2 cut(s) 144, 197
BssMI GATC 1 cut(s) 258
Bst2UI CCWGG 1 cut(s) 198
Bst4CI ACNGT 1 cut(s) 116
BstC8I GCNNGC 3 cut(s) 92, 161, 309
BstDEI CTNAG 1 cut(s) 216
BstDSI CCRYGG 1 cut(s) 144
BstF5I GGATG 1 cut(s) 238
BstKTI GATC 1 cut(s) 261
BstMBI GATC 1 cut(s) 258
BstMCI CGRYCG 1 cut(s) 54
BstMWI GCNNNNNNNGC 1 cut(s) 156
BstNI CCWGG 1 cut(s) 198
BstSCI CCNGG 1 cut(s) 196
BstSFI CTRYAG 2 cut(s) 21, 112
BstV1I GCAGC 4 cut(s) 58, 74, 291, 313
BstV2I GAAGAC 1 cut(s) 119
BstX2I RGATCY 1 cut(s) 258
BstYI RGATCY 1 cut(s) 258
BsuRI GGCC 1 cut(s) 224
BtgI CCRYGG 1 cut(s) 144
BtsCI GGATG 1 cut(s) 238
Cac8I GCNNGC 3 cut(s) 92, 161, 309
Cfr13I GGNCC 1 cut(s) 222
CviAII CATG 1 cut(s) 43
CviJI RGCY 9 cut(s) 48, 71, 111, 150, 173, 210, 224, 304, 314
CviKI_1 RGCY 9 cut(s) 48, 71, 111, 150, 173, 210, 224, 304, 314
DdeI CTNAG 1 cut(s) 216
DpnI GATC 1 cut(s) 260
DpnII GATC 1 cut(s) 258
Eco24I GRGCYC 1 cut(s) 50
Eco88I CYCGRG 1 cut(s) 57
EcoRII CCWGG 1 cut(s) 196
EcoT38I GRGCYC 1 cut(s) 50
FaeI CATG 1 cut(s) 46
FaiI YATR 3 cut(s) 44, 153, 322
FatI CATG 1 cut(s) 42
Fnu4HI GCNGC 6 cut(s) 72, 80, 88, 302, 305, 312
FokI GGATG 1 cut(s) 245
FriOI GRGCYC 1 cut(s) 50
Fsp4HI GCNGC 6 cut(s) 72, 80, 88, 302, 305, 312
FspBI CTAG 6 cut(s) 36, 68, 107, 135, 185, 308
GluI GCNGC 6 cut(s) 72, 80, 88, 302, 305, 312
HaeIII GGCC 1 cut(s) 224
Hin1II CATG 1 cut(s) 46
HinfI GANTC 1 cut(s) 39
HphI GGTGA 1 cut(s) 307
Hpy188III TCNNGA 2 cut(s) 59, 119
HpyAV CCTTC 1 cut(s) 245
HpyCH4III ACNGT 1 cut(s) 116
HpyCH4V TGCA 2 cut(s) 8, 23
HpyF10VI GCNNNNNNNGC 1 cut(s) 156
HpyF3I CTNAG 1 cut(s) 216
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 258
LmnI GCTCC 1 cut(s) 178
LpnPI CCDG 6 cut(s) 9, 104, 132, 183, 210, 238
Lsp1109I GCAGC 4 cut(s) 58, 74, 291, 313
LweI GCATC 1 cut(s) 223
MaeI CTAG 6 cut(s) 36, 68, 107, 135, 185, 308
MalI GATC 1 cut(s) 260
MbiI CCGCTC 1 cut(s) 56
MboI GATC 1 cut(s) 258
MboII GAAGA 5 cut(s) 39, 42, 74, 119, 278
MfeI CAATTG 1 cut(s) 273
MflI RGATCY 1 cut(s) 258
MhlI GDGCHC 1 cut(s) 50
MluCI AATT 1 cut(s) 273
MlyI GAGTC 1 cut(s) 33
MnlI CCTC 1 cut(s) 213
MseI TTAA 2 cut(s) 179, 189
MspA1I CMGCKG 2 cut(s) 82, 304
MspR9I CCNGG 1 cut(s) 198
MunI CAATTG 1 cut(s) 273
MvaI CCWGG 1 cut(s) 198
MwoI GCNNNNNNNGC 1 cut(s) 156
NdeII GATC 1 cut(s) 258
NheI GCTAGC 1 cut(s) 307
NlaIII CATG 1 cut(s) 46
NlaIV GGNNCC 1 cut(s) 174
PaeR7I CTCGAG 1 cut(s) 57
PkrI GCNGC 6 cut(s) 73, 81, 89, 303, 306, 313
PleI GAGTC 1 cut(s) 33
PpsI GAGTC 1 cut(s) 33
Psp6I CCWGG 1 cut(s) 196
PspGI CCWGG 1 cut(s) 196
PspN4I GGNNCC 1 cut(s) 174
PspPI GGNCC 1 cut(s) 222
PstI CTGCAG 1 cut(s) 25
PsuI RGATCY 1 cut(s) 258
PvuII CAGCTG 1 cut(s) 304
SaqAI TTAA 2 cut(s) 179, 189
SatI GCNGC 6 cut(s) 72, 80, 88, 302, 305, 312
Sau3AI GATC 1 cut(s) 258
Sau96I GGNCC 1 cut(s) 222
SchI GAGTC 1 cut(s) 33
ScrFI CCNGG 1 cut(s) 198
SduI GDGCHC 1 cut(s) 50
SetI ASST 6 cut(s) 73, 136, 199, 297, 306, 316
SfaNI GCATC 1 cut(s) 223
SfcI CTRYAG 2 cut(s) 21, 112
Sfr274I CTCGAG 1 cut(s) 57
SlaI CTCGAG 1 cut(s) 57
SmlI CTYRAG 1 cut(s) 57
SmoI CTYRAG 1 cut(s) 57
SpeI ACTAGT 1 cut(s) 184
Sse9I AATT 1 cut(s) 273
SsiI CCGC 2 cut(s) 54, 80
SspMI CTAG 6 cut(s) 36, 68, 107, 135, 185, 308
StyD4I CCNGG 1 cut(s) 196
TaaI ACNGT 1 cut(s) 116
TaqI TCGA 3 cut(s) 50, 58, 193
TasI AATT 1 cut(s) 273
TauI GCSGC 1 cut(s) 82
Tru1I TTAA 2 cut(s) 179, 189
Tru9I TTAA 2 cut(s) 179, 189
TseI GCWGC 5 cut(s) 71, 87, 301, 304, 311
TspDTI ATGAA 1 cut(s) 26
TspGWI ACGGA 1 cut(s) 165
XhoI CTCGAG 1 cut(s) 57
XspI CTAG 6 cut(s) 36, 68, 107, 135, 185, 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.