Rmu_sc0003979.1_g000001

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003979.1
N/A
Physical Location & Seq
Reverse (-)
5947 .. 6402
456 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003979.1_g000001.1.cds

Sequence Viewer

Length: 456 bp
atgaatgaagaagaagctcttgagctcttcagttggcatgcctttcaaaattcttctcctaatgaagactatatcgaactctcaagaagagtggttacttactgtggaggtttaccactggctcttgaaattttagggtctttcctctttggaaggagcataggagattggaatagcacactgaagaaattggaaaaaattcctgatggcagaattcagtcaaggctcagaataagctttgatgcaattgatgagagccagaggaacatattcctccatatatgttgttacttcatcggaatggacaagaactatgtcataaatatactgaagggctgtggtttttctccacaaatagaaatcagtgtcctgctccaacgttgccttgtaactgttagtgagaaaaacaagctcatgatgcatgatttgcttcgagacatgcaggggcggatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

151

Amino Acids

17.41

Weight (kDa)

5.92

Isoelectric Point (pI)

70.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 448
AclI AACGTT 1 cut(s) 379
AcsI RAATTY 4 cut(s) 49, 129, 198, 213
AcuI CTGAAG 3 cut(s) 13, 203, 350
AgsI TTSAA 2 cut(s) 47, 128
AluBI AGCT 4 cut(s) 17, 25, 237, 412
AluI AGCT 4 cut(s) 17, 25, 237, 412
Alw21I GWGCWC 1 cut(s) 27
Alw26I GTCTC 1 cut(s) 429
ApoI RAATTY 4 cut(s) 49, 129, 198, 213
Asp700I GAANNNNTTC 2 cut(s) 198, 269
BanII GRGCYC 1 cut(s) 27
BarI GAAGNNNNNNTAC 2 cut(s) 79, 111
BbsI GAAGAC 1 cut(s) 72
Bbv12I GWGCWC 1 cut(s) 27
BccI CCATC 1 cut(s) 200
BcoDI GTCTC 1 cut(s) 429
BfaI CTAG 1 cut(s) 454
BmsI GCATC 2 cut(s) 232, 408
BpiI GAAGAC 1 cut(s) 72
BpuEI CTTGAG 2 cut(s) 41, 67
Bse1I ACTGG 1 cut(s) 123
BseMII CTCAG 1 cut(s) 241
BseNI ACTGG 1 cut(s) 123
BsiHKAI GWGCWC 1 cut(s) 27
BsmAI GTCTC 1 cut(s) 429
Bsp1286I GDGCHC 1 cut(s) 27
Bsp143I GATC 1 cut(s) 450
BspACI CCGC 1 cut(s) 448
BspCNI CTCAG 1 cut(s) 240
BspHI TCATGA 1 cut(s) 414
BspQI GCTCTTC 1 cut(s) 32
BsrI ACTGG 1 cut(s) 123
BssMI GATC 1 cut(s) 450
Bst4CI ACNGT 2 cut(s) 104, 394
Bst6I CTCTTC 2 cut(s) 32, 82
BstAPI GCANNNNNTGC 1 cut(s) 427
BstC8I GCNNGC 1 cut(s) 39
BstDEI CTNAG 1 cut(s) 227
BstKTI GATC 1 cut(s) 453
BstMAI GTCTC 1 cut(s) 429
BstMBI GATC 1 cut(s) 450
BstMWI GCNNNNNNNGC 2 cut(s) 418, 427
BstNSI RCATGY 2 cut(s) 41, 442
BstV2I GAAGAC 1 cut(s) 72
BstX2I RGATCY 1 cut(s) 450
BstYI RGATCY 1 cut(s) 450
BtsIMutI CAGTG 3 cut(s) 116, 179, 370
Cac8I GCNNGC 1 cut(s) 39
CciI TCATGA 1 cut(s) 414
CspCI CAANNNNNGTGG 2 cut(s) 72, 107
CviAII CATG 4 cut(s) 38, 415, 422, 439
CviJI RGCY 8 cut(s) 17, 25, 122, 226, 237, 258, 336, 412
CviKI_1 RGCY 8 cut(s) 17, 25, 122, 226, 237, 258, 336, 412
DdeI CTNAG 1 cut(s) 227
DpnI GATC 1 cut(s) 452
DpnII GATC 1 cut(s) 450
Eam1104I CTCTTC 2 cut(s) 32, 82
EarI CTCTTC 2 cut(s) 32, 82
Ecl136II GAGCTC 1 cut(s) 25
Eco24I GRGCYC 1 cut(s) 27
Eco53kI GAGCTC 1 cut(s) 25
Eco57I CTGAAG 3 cut(s) 13, 203, 350
EcoICRI GAGCTC 1 cut(s) 25
EcoRI GAATTC 1 cut(s) 213
EcoT22I ATGCAT 1 cut(s) 423
EcoT38I GRGCYC 1 cut(s) 27
FaeI CATG 4 cut(s) 41, 418, 425, 442
FalI AAGNNNNNCTT 1 cut(s) 35
FatI CATG 4 cut(s) 37, 414, 421, 438
FriOI GRGCYC 1 cut(s) 27
FspBI CTAG 1 cut(s) 454
Hin1II CATG 4 cut(s) 41, 418, 425, 442
HindIII AAGCTT 1 cut(s) 235
Hpy166II GTNNAC 1 cut(s) 113
Hpy188I TCNGA 2 cut(s) 230, 299
Hpy188III TCNNGA 6 cut(s) 20, 84, 125, 203, 415, 434
Hpy8I GTNNAC 1 cut(s) 113
HpyAV CCTTC 2 cut(s) 147, 325
HpyCH4III ACNGT 2 cut(s) 104, 394
HpyCH4IV ACGT 1 cut(s) 379
HpyCH4V TGCA 3 cut(s) 245, 421, 442
HpyF10VI GCNNNNNNNGC 2 cut(s) 418, 427
HpyF3I CTNAG 1 cut(s) 227
HpySE526I ACGT 1 cut(s) 379
Hsp92II CATG 4 cut(s) 41, 418, 425, 442
Kzo9I GATC 1 cut(s) 450
LguI GCTCTTC 1 cut(s) 32
LmnI GCTCC 2 cut(s) 156, 378
LpnPI CCDG 5 cut(s) 104, 216, 272, 383, 428
LweI GCATC 2 cut(s) 232, 408
MaeI CTAG 1 cut(s) 454
MaeII ACGT 1 cut(s) 379
MaeIII GTNAC 3 cut(s) 94, 287, 388
MalI GATC 1 cut(s) 452
MboI GATC 1 cut(s) 450
MboII GAAGA 7 cut(s) 19, 20, 23, 45, 77, 99, 196
MfeI CAATTG 1 cut(s) 246
MflI RGATCY 1 cut(s) 450
MhlI GDGCHC 1 cut(s) 27
MluCI AATT 6 cut(s) 49, 129, 188, 198, 213, 246
MmeI TCCRAC 1 cut(s) 400
MnlI CCTC 4 cut(s) 101, 155, 255, 284
Mph1103I ATGCAT 1 cut(s) 423
MroXI GAANNNNTTC 2 cut(s) 198, 269
MslI CAYNNNNRTG 1 cut(s) 299
MunI CAATTG 1 cut(s) 246
MwoI GCNNNNNNNGC 2 cut(s) 418, 427
NdeII GATC 1 cut(s) 450
NlaIII CATG 4 cut(s) 41, 418, 425, 442
NsiI ATGCAT 1 cut(s) 423
NspI RCATGY 2 cut(s) 41, 442
PaeI GCATGC 1 cut(s) 41
PagI TCATGA 1 cut(s) 414
PciSI GCTCTTC 1 cut(s) 32
PdmI GAANNNNTTC 2 cut(s) 198, 269
Psp124BI GAGCTC 1 cut(s) 27
Psp1406I AACGTT 1 cut(s) 379
PsuI RGATCY 1 cut(s) 450
RseI CAYNNNNRTG 1 cut(s) 299
SacI GAGCTC 1 cut(s) 27
SapI GCTCTTC 1 cut(s) 32
Sau3AI GATC 1 cut(s) 450
SduI GDGCHC 1 cut(s) 27
SetI ASST 6 cut(s) 19, 27, 112, 239, 382, 414
SfaNI GCATC 2 cut(s) 232, 408
SmiMI CAYNNNNRTG 1 cut(s) 299
SmlI CTYRAG 2 cut(s) 20, 82
SmoI CTYRAG 2 cut(s) 20, 82
SphI GCATGC 1 cut(s) 41
Sse9I AATT 6 cut(s) 49, 129, 188, 198, 213, 246
SsiI CCGC 1 cut(s) 448
SspMI CTAG 1 cut(s) 454
SstI GAGCTC 1 cut(s) 27
TaaI ACNGT 2 cut(s) 104, 394
TaiI ACGT 1 cut(s) 382
TaqI TCGA 2 cut(s) 75, 433
TasI AATT 6 cut(s) 49, 129, 188, 198, 213, 246
TscAI CASTG 3 cut(s) 123, 186, 370
TspDTI ATGAA 4 cut(s) 17, 21, 78, 283
TspRI CASTG 3 cut(s) 123, 186, 370
XapI RAATTY 4 cut(s) 49, 129, 198, 213
XceI RCATGY 2 cut(s) 41, 442
XmnI GAANNNNTTC 2 cut(s) 198, 269
XspI CTAG 1 cut(s) 454
Zsp2I ATGCAT 1 cut(s) 423
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.