Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004031.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

70306 .. 73519

Gene Structure 3214 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004031.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1155 bp

atggataaggactttggttgtgatctcttcgcgttcaccgtatcgatactcaacattgtagggcgttaccctttcttcgctggttgtgtcgatggcagtagtactggcagtcggctcgcgaggagactaggaatggaagcacggtcgccggatcaaactgaattcttcttgtccttgaattatctcgaaattctagatttgagctataaccttcttattggagtgttaccgtcttctctaccatccagtcatattcggattgtggatctttccagcaatcgtttacatggtgcagttccatcttcttttttccaacaagcttggaatttgactagtttcaatgtcagtaacaacacctttttaggtcctatcccatcctctatttgtcgtccttcttcctcgttacgacaccttgatttttccttcaataatttcaatggtagtatatcttctggattggggaagtgttccaaactgcaggtattccttgctggtcacaattacctgtcaggatcgcttccagaagatatgtttaattctaccactcttaaagagatttcactacctctaaattcattttatggatcaatgagtgatggaattgctaacctcgccaaccttacaacccttgacctctcctataaccaattgagtagtgtgctccctctccatcttgggaagctctccaagttgaaacacatactgcttgatttcaactatctagaaggttcatttcccctatcgctgatgaattgcacaaacctcgctgaactacgtattggaaccaacaacttgggaggtgatatctccatgctcaatttttccaaacttagccaacttagtaaacttgacttgcggaaaaataacttctttggtatcttgccgagaagcatctactcgtgcaagttcttgaaagcaattcgagtgagctacaataatctagaggttcaaatacagcctgaaattctttcattgaaatccctgtccttcctctcacttggttggaacaaaggtttgaccaatgtgacaggggcgatgaagatattgatgggttgcaaacgtctcctactcctttccttggcatctgattttttaggtgaggaaatgctgaacgatgttgaaatggcggattttaatggatttcaaaatctttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002376 GO:0006950 GO:0006952 GO:0006955 GO:0008150 GO:0009605 GO:0009607 GO:0009620 GO:0009888 GO:0010073 GO:0032501 GO:0032502 GO:0043207 GO:0045087 GO:0048507 GO:0048856 GO:0050832 GO:0050896 GO:0051704 GO:0051707 GO:0098542

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

384

Amino Acids

42.37

Weight (kDa)

7.59

Isoelectric Point (pI)

38.65

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	469
AccII	CGCG	2 cut(s)	32, 119
AciI	CCGC	2 cut(s)	856, 1127
AclWI	GGATC	4 cut(s)	159, 273, 520, 592
AcsI	RAATTY	5 cut(s)	161, 189, 325, 571, 963
AfaI	GTAC	1 cut(s)	103
AfiI	CCNNNNNNNGG	1 cut(s)	1078
AhlI	ACTAGT	1 cut(s)	332
AjuI	GAANNNNNNNTTGG	2 cut(s)	762, 794
AluBI	AGCT	4 cut(s)	204, 320, 682, 930
AluI	AGCT	4 cut(s)	204, 320, 682, 930
Alw21I	GWGCWC	1 cut(s)	663
Alw26I	GTCTC	2 cut(s)	118, 1067
AlwI	GGATC	4 cut(s)	159, 273, 520, 592
ApoI	RAATTY	5 cut(s)	161, 189, 325, 571, 963
AspS9I	GGNCC	1 cut(s)	365
AsuHPI	GGTGA	3 cut(s)	28, 812, 1109
AvaII	GGWCC	1 cut(s)	365
BarI	GAAGNNNNNNTAC	2 cut(s)	433, 465
BauI	CACGAG	1 cut(s)	898
BbsI	GAAGAC	1 cut(s)	225
Bbv12I	GWGCWC	1 cut(s)	663
BccI	CCATC	7 cut(s)	86, 250, 307, 382, 590, 678, 1042
BcgI	CGANNNNNNTGC	4 cut(s)	97, 131, 745, 779
BcoDI	GTCTC	2 cut(s)	118, 1067
BcuI	ACTAGT	1 cut(s)	332
BfaI	CTAG	5 cut(s)	128, 194, 333, 722, 941
BfmI	CTRYAG	1 cut(s)	476
BfuAI	ACCTGC	1 cut(s)	469
BmcAI	AGTACT	1 cut(s)	103
Bme18I	GGWCC	1 cut(s)	365
BmgT120I	GGNCC	1 cut(s)	365
BmiI	GGNNCC	1 cut(s)	784
BmsI	GCATC	2 cut(s)	900, 1091
BpiI	GAAGAC	1 cut(s)	225
Bsa29I	ATCGAT	1 cut(s)	44
BsaAI	YACGTR	1 cut(s)	776
BsaJI	CCNNGG	1 cut(s)	1077
Bsc4I	CCNNNNNNNGG	1 cut(s)	1078
Bse1I	ACTGG	2 cut(s)	109, 246
BseCI	ATCGAT	1 cut(s)	44
BseDI	CCNNGG	1 cut(s)	1077
BseGI	GGATG	2 cut(s)	242, 374
BseLI	CCNNNNNNNGG	1 cut(s)	1078
BseNI	ACTGG	2 cut(s)	109, 246
BseRI	GAGGAG	1 cut(s)	136
BsgI	GTGCAG	1 cut(s)	312
Bsh1236I	CGCG	2 cut(s)	32, 119
Bsh1285I	CGRYCG	1 cut(s)	146
BshVI	ATCGAT	1 cut(s)	44
BsiEI	CGRYCG	1 cut(s)	146
BsiHKAI	GWGCWC	1 cut(s)	663
BsiSI	CCGG	1 cut(s)	149
BslI	CCNNNNNNNGG	1 cut(s)	1078
BsmAI	GTCTC	2 cut(s)	118, 1067
BsmBI	CGTCTC	1 cut(s)	1067
Bsp1286I	GDGCHC	1 cut(s)	663
Bsp143I	GATC	5 cut(s)	22, 151, 265, 512, 584
Bsp68I	TCGCGA	1 cut(s)	119
BspACI	CCGC	2 cut(s)	856, 1127
BspDI	ATCGAT	1 cut(s)	44
BspFNI	CGCG	2 cut(s)	32, 119
BspLI	GGNNCC	1 cut(s)	784
BspMAI	CTGCAG	1 cut(s)	480
BspMI	ACCTGC	1 cut(s)	469
BspPI	GGATC	4 cut(s)	159, 273, 520, 592
BsrI	ACTGG	2 cut(s)	109, 246
BssECI	CCNNGG	1 cut(s)	1077
BssMI	GATC	5 cut(s)	22, 151, 265, 512, 584
BssSI	CACGAG	1 cut(s)	898
BssT1I	CCWWGG	1 cut(s)	1077
Bst2BI	CACGAG	1 cut(s)	898
Bst4CI	ACNGT	3 cut(s)	40, 144, 231
Bst6I	CTCTTC	1 cut(s)	32
BstBAI	YACGTR	1 cut(s)	776
BstC8I	GCNNGC	1 cut(s)	117
BstDEI	CTNAG	2 cut(s)	830, 839
BstF5I	GGATG	2 cut(s)	242, 374
BstFNI	CGCG	2 cut(s)	32, 119
BstKTI	GATC	5 cut(s)	25, 154, 268, 515, 587
BstMAI	GTCTC	2 cut(s)	118, 1067
BstMBI	GATC	5 cut(s)	22, 151, 265, 512, 584
BstMCI	CGRYCG	1 cut(s)	146
BstMWI	GCNNNNNNNGC	1 cut(s)	611
BstSFI	CTRYAG	1 cut(s)	476
BstSNI	TACGTA	1 cut(s)	776
BstUI	CGCG	2 cut(s)	32, 119
BstV2I	GAAGAC	1 cut(s)	225
BstX2I	RGATCY	1 cut(s)	265
BstXI	CCANNNNNNTGG	1 cut(s)	793
BstYI	RGATCY	1 cut(s)	265
Bsu15I	ATCGAT	1 cut(s)	44
BsuTUI	ATCGAT	1 cut(s)	44
BtgZI	GCGATG	1 cut(s)	1049
BtsCI	GGATG	2 cut(s)	242, 374
BtuMI	TCGCGA	1 cut(s)	119
BveI	ACCTGC	1 cut(s)	469
Cac8I	GCNNGC	1 cut(s)	117
Cfr13I	GGNCC	1 cut(s)	365
ClaI	ATCGAT	1 cut(s)	44
Csp6I	GTAC	1 cut(s)	102
CviAII	CATG	2 cut(s)	287, 811
CviJI	RGCY	7 cut(s)	115, 204, 320, 682, 834, 930, 958
CviKI_1	RGCY	7 cut(s)	115, 204, 320, 682, 834, 930, 958
CviQI	GTAC	1 cut(s)	102
DdeI	CTNAG	2 cut(s)	830, 839
DpnI	GATC	5 cut(s)	24, 153, 267, 514, 586
DpnII	GATC	5 cut(s)	22, 151, 265, 512, 584
Eam1104I	CTCTTC	1 cut(s)	32
EarI	CTCTTC	1 cut(s)	32
EciI	GGCGGA	1 cut(s)	1142
Eco105I	TACGTA	1 cut(s)	776
Eco130I	CCWWGG	1 cut(s)	1077
Eco32I	GATATC	1 cut(s)	805
Eco47I	GGWCC	1 cut(s)	365
EcoO109I	RGGNCCY	1 cut(s)	365
EcoRI	GAATTC	1 cut(s)	161
EcoRV	GATATC	1 cut(s)	805
EcoT14I	CCWWGG	1 cut(s)	1077
ErhI	CCWWGG	1 cut(s)	1077
Esp3I	CGTCTC	1 cut(s)	1067
FaeI	CATG	2 cut(s)	290, 814
FaiI	YATR	9 cut(s)	207, 252, 288, 446, 530, 582, 642, 701, 812
FatI	CATG	2 cut(s)	286, 810
FokI	GGATG	2 cut(s)	229, 361
FspBI	CTAG	5 cut(s)	128, 194, 333, 722, 941
HapII	CCGG	1 cut(s)	149
Hin1II	CATG	2 cut(s)	290, 814
HindIII	AAGCTT	1 cut(s)	318
HpaII	CCGG	1 cut(s)	149
HphI	GGTGA	3 cut(s)	28, 812, 1109
Hpy166II	GTNNAC	3 cut(s)	36, 284, 845
Hpy188I	TCNGA	2 cut(s)	258, 1087
Hpy188III	TCNNGA	9 cut(s)	118, 185, 194, 453, 510, 521, 722, 910, 941
Hpy8I	GTNNAC	3 cut(s)	36, 284, 845
HpyAV	CCTTC	5 cut(s)	221, 402, 433, 719, 997
HpyCH4III	ACNGT	3 cut(s)	40, 144, 231
HpyCH4IV	ACGT	2 cut(s)	775, 1060
HpyCH4V	TGCA	5 cut(s)	293, 478, 756, 903, 1056
HpyF10VI	GCNNNNNNNGC	1 cut(s)	611
HpyF3I	CTNAG	2 cut(s)	830, 839
HpySE526I	ACGT	2 cut(s)	775, 1060
Hsp92II	CATG	2 cut(s)	290, 814
Kzo9I	GATC	5 cut(s)	22, 151, 265, 512, 584
LmnI	GCTCC	1 cut(s)	666
LweI	GCATC	2 cut(s)	900, 1091
MaeI	CTAG	5 cut(s)	128, 194, 333, 722, 941
MaeII	ACGT	2 cut(s)	775, 1060
MaeIII	GTNAC	6 cut(s)	65, 225, 347, 402, 494, 1024
MalI	GATC	5 cut(s)	24, 153, 267, 514, 586
MboI	GATC	5 cut(s)	22, 151, 265, 512, 584
MboII	GAAGA	9 cut(s)	19, 67, 157, 225, 294, 387, 441, 536, 1051
MfeI	CAATTG	1 cut(s)	647
MflI	RGATCY	1 cut(s)	265
MhlI	GDGCHC	1 cut(s)	663
MmeI	TCCRAC	2 cut(s)	337, 983
MseI	TTAA	3 cut(s)	534, 549, 1134
MspI	CCGG	1 cut(s)	149
MunI	CAATTG	1 cut(s)	647
MvnI	CGCG	2 cut(s)	32, 119
MwoI	GCNNNNNNNGC	1 cut(s)	611
NdeII	GATC	5 cut(s)	22, 151, 265, 512, 584
NlaIII	CATG	2 cut(s)	290, 814
NlaIV	GGNNCC	1 cut(s)	784
NmeAIII	GCCGAG	1 cut(s)	909
NmuCI	GTSAC	2 cut(s)	494, 1024
NruI	TCGCGA	1 cut(s)	119
PcsI	WCGNNNNNNNCGW	1 cut(s)	36
Ppu21I	YACGTR	1 cut(s)	776
PpuMI	RGGWCCY	1 cut(s)	365
Psp5II	RGGWCCY	1 cut(s)	365
PspN4I	GGNNCC	1 cut(s)	784
PspPI	GGNCC	1 cut(s)	365
PspPPI	RGGWCCY	1 cut(s)	365
PstI	CTGCAG	1 cut(s)	480
PsuI	RGATCY	1 cut(s)	265
RruI	TCGCGA	1 cut(s)	119
RsaI	GTAC	1 cut(s)	103
RsaNI	GTAC	1 cut(s)	102
SaqAI	TTAA	3 cut(s)	534, 549, 1134
Sau3AI	GATC	5 cut(s)	22, 151, 265, 512, 584
Sau96I	GGNCC	1 cut(s)	365
ScaI	AGTACT	1 cut(s)	103
SduI	GDGCHC	1 cut(s)	663
SfaNI	GCATC	2 cut(s)	900, 1091
SfcI	CTRYAG	1 cut(s)	476
SinI	GGWCC	1 cut(s)	365
SnaBI	TACGTA	1 cut(s)	776
SpeI	ACTAGT	1 cut(s)	332
SsiI	CCGC	2 cut(s)	856, 1127
SspMI	CTAG	5 cut(s)	128, 194, 333, 722, 941
StyI	CCWWGG	1 cut(s)	1077
TaaI	ACNGT	3 cut(s)	40, 144, 231
TaiI	ACGT	2 cut(s)	778, 1063
TaqI	TCGA	4 cut(s)	44, 90, 186, 922
TatI	WGTACW	1 cut(s)	101
Tru1I	TTAA	3 cut(s)	534, 549, 1134
Tru9I	TTAA	3 cut(s)	534, 549, 1134
TseFI	GTSAC	2 cut(s)	494, 1024
Tsp45I	GTSAC	2 cut(s)	494, 1024
TspDTI	ATGAA	5 cut(s)	564, 720, 764, 960, 1052
VpaK11BI	GGWCC	1 cut(s)	365
XapI	RAATTY	5 cut(s)	161, 189, 325, 571, 963
XbaI	TCTAGA	3 cut(s)	193, 721, 940
XspI	CTAG	5 cut(s)	128, 194, 333, 722, 941
ZrmI	AGTACT	1 cut(s)	103

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.