Rmu_sc0004165.1_g000093

intracellular protein transport protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004165.1
N/A
Physical Location & Seq
Reverse (-)
355495 .. 356214
720 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 396 bp
atgtcctgtaatggaaacaggaccctggctgcagatagggaagatggcaagctgggagaagaaaatctagctatggttgacaatcttgaagaatccatatactctgatgcaatcagagaaggtctacacgaattacaaagcaaaatggtggaggcacatgggttaaaatccaatcatcctaacagtaactgcagggtgaaaacttgtatccattctgtgtttacaggtaatgctagtccactagggttcgctgccgccaagctgtttctcccaccacaagctcgccataggctacctcggccccctacactccggcttctcgaggttgacggcgacggcaggagaagtggagtggaggcactgagaaatggcttctcttccgggttcggagtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.23

Weight (kDa)

6.96

Isoelectric Point (pI)

46.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 124
AciI CCGC 1 cut(s) 255
AgsI TTSAA 1 cut(s) 89
AjnI CCWGG 1 cut(s) 24
AluBI AGCT 4 cut(s) 52, 71, 262, 281
AluI AGCT 4 cut(s) 52, 71, 262, 281
AlwNI CAGNNNCTG 1 cut(s) 189
Ama87I CYCGRG 1 cut(s) 320
AoxI GGCC 1 cut(s) 299
ApeKI GCWGC 2 cut(s) 29, 251
AspS9I GGNCC 2 cut(s) 21, 300
AsuC2I CCSGG 1 cut(s) 382
AsuHPI GGTGA 1 cut(s) 208
AvaI CYCGRG 1 cut(s) 320
AvaII GGWCC 1 cut(s) 21
BbvI GCAGC 2 cut(s) 16, 238
BccI CCATC 1 cut(s) 38
BceAI ACGGC 2 cut(s) 346, 352
BciT130I CCWGG 1 cut(s) 26
BciVI GTATCC 1 cut(s) 218
BcnI CCSGG 1 cut(s) 382
BfaI CTAG 3 cut(s) 68, 234, 242
BfmI CTRYAG 2 cut(s) 30, 190
BfuI GTATCC 1 cut(s) 218
BisI GCNGC 3 cut(s) 30, 252, 255
BlsI GCNGC 3 cut(s) 31, 253, 256
Bme1390I CCNGG 2 cut(s) 26, 382
Bme18I GGWCC 1 cut(s) 21
BmeT110I CYCGRG 1 cut(s) 320
BmgT120I GGNCC 2 cut(s) 21, 300
BmiI GGNNCC 2 cut(s) 23, 302
BmrFI CCNGG 2 cut(s) 26, 382
BmsI GCATC 1 cut(s) 97
BpuMI CCSGG 1 cut(s) 382
BsaJI CCNNGG 2 cut(s) 24, 296
BseBI CCWGG 1 cut(s) 26
BseDI CCNNGG 2 cut(s) 24, 296
BseGI GGATG 1 cut(s) 175
BseMII CTCAG 1 cut(s) 353
BseXI GCAGC 2 cut(s) 16, 238
BseYI CCCAGC 1 cut(s) 52
BshFI GGCC 1 cut(s) 301
BsiHKCI CYCGRG 1 cut(s) 320
BsiSI CCGG 2 cut(s) 313, 381
BsnI GGCC 1 cut(s) 301
BsoBI CYCGRG 1 cut(s) 320
BspACI CCGC 1 cut(s) 255
BspANI GGCC 1 cut(s) 301
BspCNI CTCAG 1 cut(s) 354
BspLI GGNNCC 2 cut(s) 23, 302
BspMAI CTGCAG 2 cut(s) 34, 194
BssECI CCNNGG 2 cut(s) 24, 296
Bst2UI CCWGG 1 cut(s) 26
Bst4CI ACNGT 1 cut(s) 185
Bst6I CTCTTC 1 cut(s) 382
BstC8I GCNNGC 2 cut(s) 50, 283
BstDEI CTNAG 1 cut(s) 362
BstF5I GGATG 1 cut(s) 175
BstMWI GCNNNNNNNGC 1 cut(s) 298
BstNI CCWGG 1 cut(s) 26
BstSCI CCNGG 2 cut(s) 24, 380
BstSFI CTRYAG 2 cut(s) 30, 190
BstV1I GCAGC 2 cut(s) 16, 238
BsuI GTATCC 1 cut(s) 218
BsuRI GGCC 1 cut(s) 301
BtsCI GGATG 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 359
Cac8I GCNNGC 2 cut(s) 50, 283
CaiI CAGNNNCTG 1 cut(s) 189
Cfr13I GGNCC 2 cut(s) 21, 300
CviAII CATG 1 cut(s) 158
CviJI RGCY 9 cut(s) 29, 52, 71, 262, 281, 292, 301, 316, 372
CviKI_1 RGCY 9 cut(s) 29, 52, 71, 262, 281, 292, 301, 316, 372
DdeI CTNAG 1 cut(s) 362
Eam1104I CTCTTC 1 cut(s) 382
EarI CTCTTC 1 cut(s) 382
Eco47I GGWCC 1 cut(s) 21
Eco88I CYCGRG 1 cut(s) 320
EcoO109I RGGNCCY 1 cut(s) 21
EcoRII CCWGG 1 cut(s) 24
FaeI CATG 1 cut(s) 161
FaiI YATR 5 cut(s) 74, 98, 100, 159, 288
FatI CATG 1 cut(s) 157
FblI GTMKAC 1 cut(s) 124
Fnu4HI GCNGC 3 cut(s) 30, 252, 255
FokI GGATG 1 cut(s) 162
Fsp4HI GCNGC 3 cut(s) 30, 252, 255
FspBI CTAG 3 cut(s) 68, 234, 242
GluI GCNGC 3 cut(s) 30, 252, 255
GsaI CCCAGC 1 cut(s) 56
HaeIII GGCC 1 cut(s) 301
HapII CCGG 2 cut(s) 313, 381
Hin1II CATG 1 cut(s) 161
HincII GTYRAC 2 cut(s) 79, 328
HindII GTYRAC 2 cut(s) 79, 328
HinfI GANTC 2 cut(s) 92, 390
HpaII CCGG 2 cut(s) 313, 381
HphI GGTGA 1 cut(s) 208
Hpy166II GTNNAC 5 cut(s) 79, 125, 222, 239, 328
Hpy188I TCNGA 4 cut(s) 106, 116, 389, 395
Hpy188III TCNNGA 2 cut(s) 86, 320
Hpy8I GTNNAC 5 cut(s) 79, 125, 222, 239, 328
Hpy99I CGWCG 1 cut(s) 338
HpyAV CCTTC 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 185
HpyCH4V TGCA 3 cut(s) 32, 110, 192
HpyF10VI GCNNNNNNNGC 1 cut(s) 298
HpyF3I CTNAG 1 cut(s) 362
Hsp92II CATG 1 cut(s) 161
LpnPI CCDG 9 cut(s) 4, 11, 19, 38, 38, 178, 210, 325, 326
Lsp1109I GCAGC 2 cut(s) 16, 238
LweI GCATC 1 cut(s) 97
MaeI CTAG 3 cut(s) 68, 234, 242
MaeIII GTNAC 1 cut(s) 185
MboII GAAGA 4 cut(s) 53, 71, 101, 369
MluCI AATT 1 cut(s) 131
MnlI CCTC 4 cut(s) 145, 306, 316, 349
MseI TTAA 1 cut(s) 164
MspI CCGG 2 cut(s) 313, 381
MspR9I CCNGG 2 cut(s) 26, 382
MvaI CCWGG 1 cut(s) 26
MwoI GCNNNNNNNGC 1 cut(s) 298
NciI CCSGG 1 cut(s) 382
NlaIII CATG 1 cut(s) 161
NlaIV GGNNCC 2 cut(s) 23, 302
NmeAIII GCCGAG 1 cut(s) 277
PaeR7I CTCGAG 1 cut(s) 320
PfeI GAWTC 1 cut(s) 92
PkrI GCNGC 3 cut(s) 31, 253, 256
PpuMI RGGWCCY 1 cut(s) 21
Psp5II RGGWCCY 1 cut(s) 21
Psp6I CCWGG 1 cut(s) 24
PspFI CCCAGC 1 cut(s) 52
PspGI CCWGG 1 cut(s) 24
PspN4I GGNNCC 2 cut(s) 23, 302
PspPI GGNCC 2 cut(s) 21, 300
PspPPI RGGWCCY 1 cut(s) 21
PstI CTGCAG 2 cut(s) 34, 194
PstNI CAGNNNCTG 1 cut(s) 189
SaqAI TTAA 1 cut(s) 164
SatI GCNGC 3 cut(s) 30, 252, 255
Sau96I GGNCC 2 cut(s) 21, 300
ScrFI CCNGG 2 cut(s) 26, 382
SetI ASST 8 cut(s) 54, 73, 124, 229, 264, 283, 298, 327
SfaNI GCATC 1 cut(s) 97
SfcI CTRYAG 2 cut(s) 30, 190
Sfr274I CTCGAG 1 cut(s) 320
SinI GGWCC 1 cut(s) 21
SlaI CTCGAG 1 cut(s) 320
SmlI CTYRAG 1 cut(s) 320
SmoI CTYRAG 1 cut(s) 320
Sse9I AATT 1 cut(s) 131
SsiI CCGC 1 cut(s) 255
SspMI CTAG 3 cut(s) 68, 234, 242
StyD4I CCNGG 2 cut(s) 24, 380
TaaI ACNGT 1 cut(s) 185
TaqI TCGA 1 cut(s) 321
TasI AATT 1 cut(s) 131
TauI GCSGC 1 cut(s) 257
TfiI GAWTC 1 cut(s) 92
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 1 cut(s) 366
TseI GCWGC 2 cut(s) 29, 251
TspRI CASTG 1 cut(s) 366
VpaK11BI GGWCC 1 cut(s) 21
XhoI CTCGAG 1 cut(s) 320
XmiI GTMKAC 1 cut(s) 124
XspI CTAG 3 cut(s) 68, 234, 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.