Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004359.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

106735 .. 107640

Gene Structure 906 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

atgcatgactcggagacagaaaccgatgttgaattctggctaggggaactgcccggagatcaacgatcaccgactaacagatctgacgacaaccaatatggctgtgcaaccgcgagaaactacaatcaacgacttagtggtcgagattttgttcaccttcttccgctgcatcatttggtggatgagttaacactcgccgttggacggaggggaaatgacctccctgcagcaacagaagttgtcaaactctacaagaaacatagtatcaccaaaatgaggctttttgatccaaacacagcagcccttcaggcactgaaagggagcggaatcagtgtcatacttggcattcaaaaccaatacttacccgcactggcagcaagtcaagaagctgtgaacgcatggttcaccaccaatgttgagccttaccttgccttaccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001871 GO:0003674 GO:0003824 GO:0004338 GO:0004553 GO:0005488 GO:0005575 GO:0005623 GO:0005886 GO:0008422 GO:0015926 GO:0016020 GO:0016787 GO:0016798 GO:0030246 GO:0030247 GO:0031224 GO:0031225 GO:0031226 GO:0044425 GO:0044459 GO:0044464 GO:0046658 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Glyco_hydro_17

Protein Analysis

146

Amino Acids

16.22

Weight (kDa)

5.67

Isoelectric Point (pI)

40.36

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Glyco_hydro_17	PF00332	64 - 142	2.1e-17	Glycosyl hydrolases family 17

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	138
AccBSI	CCGCTC	1 cut(s)	324
AccII	CGCG	1 cut(s)	113
AciI	CCGC	4 cut(s)	111, 164, 324, 366
AclWI	GGATC	1 cut(s)	281
AcsI	RAATTY	1 cut(s)	32
AcuI	CTGAAG	1 cut(s)	290
AfiI	CCNNNNNNNGG	2 cut(s)	204, 276
AgsI	TTSAA	2 cut(s)	32, 350
AluBI	AGCT	1 cut(s)	389
AluI	AGCT	1 cut(s)	389
Alw26I	GTCTC	1 cut(s)	8
AlwI	GGATC	1 cut(s)	281
AlwNI	CAGNNNCTG	1 cut(s)	313
ApeKI	GCWGC	4 cut(s)	166, 227, 299, 374
ApoI	RAATTY	1 cut(s)	32
AsuC2I	CCSGG	1 cut(s)	54
AsuHPI	GGTGA	4 cut(s)	60, 146, 259, 397
BbvI	GCAGC	4 cut(s)	153, 239, 311, 386
BceAI	ACGGC	1 cut(s)	182
BcnI	CCSGG	1 cut(s)	54
BcoDI	GTCTC	1 cut(s)	8
BfaI	CTAG	1 cut(s)	41
BfmI	CTRYAG	1 cut(s)	225
BglI	GCCNNNNNGGC	1 cut(s)	308
BglII	AGATCT	1 cut(s)	80
BisI	GCNGC	4 cut(s)	167, 228, 300, 375
BlsI	GCNGC	4 cut(s)	168, 229, 301, 376
Bme1390I	CCNGG	1 cut(s)	54
BmrFI	CCNGG	1 cut(s)	54
BmsI	GCATC	1 cut(s)	178
BpuMI	CCSGG	1 cut(s)	54
Bsc4I	CCNNNNNNNGG	2 cut(s)	204, 276
Bse1I	ACTGG	1 cut(s)	375
BseGI	GGATG	1 cut(s)	187
BseLI	CCNNNNNNNGG	2 cut(s)	204, 276
BseNI	ACTGG	1 cut(s)	375
BseXI	GCAGC	4 cut(s)	153, 239, 311, 386
Bsh1236I	CGCG	1 cut(s)	113
BsiSI	CCGG	1 cut(s)	54
BslI	CCNNNNNNNGG	2 cut(s)	204, 276
BsmAI	GTCTC	1 cut(s)	8
BsmI	GAATGC	1 cut(s)	345
Bsp143I	GATC	4 cut(s)	58, 65, 80, 286
BspACI	CCGC	4 cut(s)	111, 164, 324, 366
BspFNI	CGCG	1 cut(s)	113
BspMAI	CTGCAG	1 cut(s)	229
BspPI	GGATC	1 cut(s)	281
BsrBI	CCGCTC	1 cut(s)	324
BsrI	ACTGG	1 cut(s)	375
BssMI	GATC	4 cut(s)	58, 65, 80, 286
BstDEI	CTNAG	1 cut(s)	134
BstF5I	GGATG	1 cut(s)	187
BstFNI	CGCG	1 cut(s)	113
BstKTI	GATC	4 cut(s)	61, 68, 83, 289
BstMAI	GTCTC	1 cut(s)	8
BstMBI	GATC	4 cut(s)	58, 65, 80, 286
BstMWI	GCNNNNNNNGC	3 cut(s)	308, 374, 395
BstSCI	CCNGG	1 cut(s)	52
BstSFI	CTRYAG	1 cut(s)	225
BstUI	CGCG	1 cut(s)	113
BstV1I	GCAGC	4 cut(s)	153, 239, 311, 386
BstX2I	RGATCY	1 cut(s)	80
BstYI	RGATCY	1 cut(s)	80
BtsCI	GGATG	1 cut(s)	187
BtsIMutI	CAGTG	3 cut(s)	311, 337, 368
CaiI	CAGNNNCTG	1 cut(s)	313
CspCI	CAANNNNNGTGG	2 cut(s)	397, 432
CviAII	CATG	2 cut(s)	5, 399
CviJI	RGCY	6 cut(s)	40, 102, 280, 302, 389, 421
CviKI_1	RGCY	6 cut(s)	40, 102, 280, 302, 389, 421
DdeI	CTNAG	1 cut(s)	134
DpnI	GATC	4 cut(s)	60, 67, 82, 288
DpnII	GATC	4 cut(s)	58, 65, 80, 286
DrdI	GACNNNNNNGTC	1 cut(s)	138
DseDI	GACNNNNNNGTC	1 cut(s)	138
Eco57I	CTGAAG	1 cut(s)	290
EcoRI	GAATTC	1 cut(s)	32
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	2 cut(s)	8, 402
FaiI	YATR	5 cut(s)	6, 99, 261, 338, 400
FatI	CATG	2 cut(s)	4, 398
FauI	CCCGC	1 cut(s)	373
Fnu4HI	GCNGC	4 cut(s)	167, 228, 300, 375
FokI	GGATG	1 cut(s)	194
Fsp4HI	GCNGC	4 cut(s)	167, 228, 300, 375
FspBI	CTAG	1 cut(s)	41
GluI	GCNGC	4 cut(s)	167, 228, 300, 375
HapII	CCGG	1 cut(s)	54
Hin1II	CATG	2 cut(s)	8, 402
HincII	GTYRAC	1 cut(s)	189
HindII	GTYRAC	1 cut(s)	189
HinfI	GANTC	2 cut(s)	8, 327
HpaI	GTTAAC	1 cut(s)	189
HpaII	CCGG	1 cut(s)	54
HphI	GGTGA	4 cut(s)	60, 146, 259, 397
Hpy166II	GTNNAC	4 cut(s)	154, 189, 394, 405
Hpy188I	TCNGA	2 cut(s)	13, 85
Hpy188III	TCNNGA	2 cut(s)	143, 383
Hpy8I	GTNNAC	4 cut(s)	154, 189, 394, 405
HpyAV	CCTTC	2 cut(s)	167, 314
HpyCH4V	TGCA	4 cut(s)	4, 107, 169, 227
HpyF10VI	GCNNNNNNNGC	3 cut(s)	308, 374, 395
HpyF3I	CTNAG	1 cut(s)	134
Hsp92II	CATG	2 cut(s)	8, 402
KspAI	GTTAAC	1 cut(s)	189
Kzo9I	GATC	4 cut(s)	58, 65, 80, 286
LmnI	GCTCC	1 cut(s)	321
LpnPI	CCDG	5 cut(s)	22, 67, 237, 293, 356
Lsp1109I	GCAGC	4 cut(s)	153, 239, 311, 386
LweI	GCATC	1 cut(s)	178
MaeI	CTAG	1 cut(s)	41
MalI	GATC	4 cut(s)	60, 67, 82, 288
MbiI	CCGCTC	1 cut(s)	324
MboI	GATC	4 cut(s)	58, 65, 80, 286
MboII	GAAGA	1 cut(s)	152
MflI	RGATCY	1 cut(s)	80
MluCI	AATT	1 cut(s)	32
MlyI	GAGTC	1 cut(s)	2
MmeI	TCCRAC	1 cut(s)	181
MnlI	CCTC	3 cut(s)	201, 230, 270
Mph1103I	ATGCAT	1 cut(s)	6
MseI	TTAA	1 cut(s)	188
MslI	CAYNNNNRTG	1 cut(s)	272
MspA1I	CMGCKG	1 cut(s)	166
MspI	CCGG	1 cut(s)	54
MspR9I	CCNGG	1 cut(s)	54
Mva1269I	GAATGC	1 cut(s)	345
MvnI	CGCG	1 cut(s)	113
MwoI	GCNNNNNNNGC	3 cut(s)	308, 374, 395
NciI	CCSGG	1 cut(s)	54
NdeII	GATC	4 cut(s)	58, 65, 80, 286
NlaIII	CATG	2 cut(s)	8, 402
NsiI	ATGCAT	1 cut(s)	6
PctI	GAATGC	1 cut(s)	345
PfeI	GAWTC	1 cut(s)	327
PkrI	GCNGC	4 cut(s)	168, 229, 301, 376
PleI	GAGTC	1 cut(s)	2
PpsI	GAGTC	1 cut(s)	2
PstI	CTGCAG	1 cut(s)	229
PstNI	CAGNNNCTG	1 cut(s)	313
PsuI	RGATCY	1 cut(s)	80
RseI	CAYNNNNRTG	1 cut(s)	272
SaqAI	TTAA	1 cut(s)	188
SatI	GCNGC	4 cut(s)	167, 228, 300, 375
Sau3AI	GATC	4 cut(s)	58, 65, 80, 286
SchI	GAGTC	1 cut(s)	2
ScrFI	CCNGG	1 cut(s)	54
SetI	ASST	5 cut(s)	159, 222, 391, 429, 439
SfaNI	GCATC	1 cut(s)	178
SfcI	CTRYAG	1 cut(s)	225
SmiMI	CAYNNNNRTG	1 cut(s)	272
Sse9I	AATT	1 cut(s)	32
SsiI	CCGC	4 cut(s)	111, 164, 324, 366
SspMI	CTAG	1 cut(s)	41
StyD4I	CCNGG	1 cut(s)	52
TaqI	TCGA	1 cut(s)	142
TasI	AATT	1 cut(s)	32
TfiI	GAWTC	1 cut(s)	327
Tru1I	TTAA	1 cut(s)	188
Tru9I	TTAA	1 cut(s)	188
TscAI	CASTG	3 cut(s)	318, 337, 375
TseI	GCWGC	4 cut(s)	166, 227, 299, 374
TspGWI	ACGGA	1 cut(s)	220
TspRI	CASTG	3 cut(s)	318, 337, 375
XapI	RAATTY	1 cut(s)	32
XspI	CTAG	1 cut(s)	41
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.