Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004402.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 995

Gene Structure 995 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 196 bp

atggtagtgaaagtttatggtccagttagggcagcctgcccccagagggtgatggtttgtcttttggagaaaggagttgagtttgagcttgtgcatgttgatcttcaagcaggagagcagaagcaacctcacattcttgcccgacagccgtttgggcaagttccagcaattgaagatggcgatttcaagctttttg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000325 GO:0003674 GO:0003824 GO:0004364 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005773 GO:0005774 GO:0006518 GO:0006575 GO:0006749 GO:0006790 GO:0006807 GO:0006950 GO:0006979 GO:0008150 GO:0008152 GO:0009056 GO:0009404 GO:0009407 GO:0009636 GO:0009705 GO:0009812 GO:0009889 GO:0009962 GO:0009987 GO:0016020 GO:0016740 GO:0016765 GO:0019222 GO:0019748 GO:0031090 GO:0034641 GO:0042221 GO:0042440 GO:0043167 GO:0043169 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043603 GO:0044237 GO:0044248 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0046283 GO:0050789 GO:0050896 GO:0051186 GO:0065007 GO:0071704 GO:0080090 GO:0098588 GO:0098754 GO:0098805 GO:1900384 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko00480 ko00980 ko00982 ko00983 ko01524 ko05200 ko05204 ko05225 ko05418 map00480 map00980 map00982 map00983 map01524 map05200 map05204 map05225 map05418

Pfam Domains

Protein Families

GST_C GST_N

Protein Analysis

65

Amino Acids

7.28

Weight (kDa)

6.03

Isoelectric Point (pI)

62.37

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
GST_N	PF02798	1 - 65	1.7e-12	Glutathione S-transferase, N-terminal domain
GST_N_3	PF13417	12 - 64	6.1e-07	Glutathione S-transferase, N-terminal domain
GST_N_2	PF13409	13 - 60	6.2e-09	Glutathione S-transferase, N-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	46
AgsI	TTSAA	3 cut(s)	107, 173, 187
AluBI	AGCT	2 cut(s)	88, 190
AluI	AGCT	2 cut(s)	88, 190
ApeKI	GCWGC	1 cut(s)	32
AspS9I	GGNCC	1 cut(s)	20
AsuHPI	GGTGA	1 cut(s)	61
AvaII	GGWCC	1 cut(s)	20
BbvI	GCAGC	1 cut(s)	44
BccI	CCATC	2 cut(s)	46, 170
BceAI	ACGGC	1 cut(s)	133
BglI	GCCNNNNNGGC	1 cut(s)	154
BisI	GCNGC	1 cut(s)	33
BlsI	GCNGC	1 cut(s)	34
Bme18I	GGWCC	1 cut(s)	20
BmgT120I	GGNCC	1 cut(s)	20
Bsc4I	CCNNNNNNNGG	1 cut(s)	46
Bse1I	ACTGG	1 cut(s)	23
BseLI	CCNNNNNNNGG	1 cut(s)	46
BseNI	ACTGG	1 cut(s)	23
BseXI	GCAGC	1 cut(s)	44
BslI	CCNNNNNNNGG	1 cut(s)	46
Bsp143I	GATC	1 cut(s)	100
BsrI	ACTGG	1 cut(s)	23
BssMI	GATC	1 cut(s)	100
BstC8I	GCNNGC	1 cut(s)	37
BstKTI	GATC	1 cut(s)	103
BstMBI	GATC	1 cut(s)	100
BstMWI	GCNNNNNNNGC	1 cut(s)	154
BstNSI	RCATGY	1 cut(s)	98
BstV1I	GCAGC	1 cut(s)	44
Cac8I	GCNNGC	1 cut(s)	37
Cfr13I	GGNCC	1 cut(s)	20
CviAII	CATG	1 cut(s)	95
CviJI	RGCY	4 cut(s)	35, 88, 148, 190
CviKI_1	RGCY	4 cut(s)	35, 88, 148, 190
DpnI	GATC	1 cut(s)	102
DpnII	GATC	1 cut(s)	100
Eco47I	GGWCC	1 cut(s)	20
FaeI	CATG	1 cut(s)	98
FaiI	YATR	2 cut(s)	18, 96
FatI	CATG	1 cut(s)	94
Fnu4HI	GCNGC	1 cut(s)	33
Fsp4HI	GCNGC	1 cut(s)	33
GluI	GCNGC	1 cut(s)	33
Hin1II	CATG	1 cut(s)	98
HindIII	AAGCTT	1 cut(s)	188
HphI	GGTGA	1 cut(s)	61
HpyCH4V	TGCA	1 cut(s)	94
HpyF10VI	GCNNNNNNNGC	1 cut(s)	154
Hsp92II	CATG	1 cut(s)	98
Kzo9I	GATC	1 cut(s)	100
LpnPI	CCDG	5 cut(s)	36, 49, 56, 96, 177
Lsp1109I	GCAGC	1 cut(s)	44
MalI	GATC	1 cut(s)	102
MboI	GATC	1 cut(s)	100
MboII	GAAGA	2 cut(s)	95, 185
MfeI	CAATTG	1 cut(s)	168
MluCI	AATT	1 cut(s)	168
MnlI	CCTC	2 cut(s)	39, 138
MunI	CAATTG	1 cut(s)	168
MwoI	GCNNNNNNNGC	1 cut(s)	154
NdeII	GATC	1 cut(s)	100
NlaIII	CATG	1 cut(s)	98
NspI	RCATGY	1 cut(s)	98
PkrI	GCNGC	1 cut(s)	34
PspPI	GGNCC	1 cut(s)	20
SatI	GCNGC	1 cut(s)	33
Sau3AI	GATC	1 cut(s)	100
Sau96I	GGNCC	1 cut(s)	20
SetI	ASST	3 cut(s)	90, 130, 192
SinI	GGWCC	1 cut(s)	20
Sse9I	AATT	1 cut(s)	168
TasI	AATT	1 cut(s)	168
TseI	GCWGC	1 cut(s)	32
VpaK11BI	GGWCC	1 cut(s)	20
XceI	RCATGY	1 cut(s)	98

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.