Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004536.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

20319 .. 22804

Gene Structure 2486 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 681 bp

atggtggttccattgacctaccctgatggtcggagatcggtgacagaagaaatagagtcctccagatccactttctctctcctccttctctttcttagtcgaacgtttctctacctactatacaccgagatcgactcatttagtgaaatcagatctcaaaatcaattgtttcagactatcaagagtgtcgaaagaaattccgaagaaaggaaaacaatagaagctcttgctttgttgggatcgggggaagagaagaagaggtttttcatcagagccacacatgatgcctctagatcttcttggggaaacactggaacaaatgataaagaggatatatcatccacgctatccgatccaggcccaatttgggatgctgagccaaagtgggatactgaacctaattgggatgtggaaaatcctattgaattgccagggccatcagatgacgtagaagcaggaacaaaggaagttgtgcccaggtatcaagataaatgggttgtgaccaagggtgaactatatgctcaggcatttttaagaaaaggagagccacatccagtggaacctataattgatagcagcagatactttgttcttcgtgcagaggagaacattagtgagctaaggtcgacttcggcatgctttcattggcttagaatttcaagaaagaacagaagcttatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006629 GO:0006643 GO:0006665 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0008610 GO:0009058 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0017050 GO:0030148 GO:0044237 GO:0044238 GO:0044249 GO:0044255 GO:0046467 GO:0071704 GO:1901564 GO:1901566 GO:1901576

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DAGK_cat

Protein Analysis

226

Amino Acids

25.96

Weight (kDa)

5.11

Isoelectric Point (pI)

65.84

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DUF1681	PF07933	168 - 203	5e-06	Protein of unknown function (DUF1681)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	626
AclI	AACGTT	1 cut(s)	104
AclWI	GGATC	3 cut(s)	60, 247, 347
AcsI	RAATTY	2 cut(s)	196, 654
AfiI	CCNNNNNNNGG	2 cut(s)	207, 367
AgsI	TTSAA	2 cut(s)	425, 660
AjnI	CCWGG	3 cut(s)	355, 430, 476
AluBI	AGCT	3 cut(s)	224, 619, 675
AluI	AGCT	3 cut(s)	224, 619, 675
AlwI	GGATC	3 cut(s)	60, 247, 347
AoxI	GGCC	2 cut(s)	358, 434
ApeKI	GCWGC	1 cut(s)	576
ApoI	RAATTY	2 cut(s)	196, 654
AspS9I	GGNCC	2 cut(s)	359, 434
AsuHPI	GGTGA	2 cut(s)	52, 521
BaeGI	GKGCMC	1 cut(s)	477
BbvI	GCAGC	1 cut(s)	588
BccI	CCATC	2 cut(s)	20, 445
BciT130I	CCWGG	3 cut(s)	357, 432, 478
BciVI	GTATCC	1 cut(s)	382
BfaI	CTAG	1 cut(s)	291
BfuI	GTATCC	1 cut(s)	382
BglII	AGATCT	2 cut(s)	152, 293
BisI	GCNGC	1 cut(s)	577
BlpI	GCTNAGC	1 cut(s)	375
BlsI	GCNGC	1 cut(s)	578
Bme1390I	CCNGG	3 cut(s)	357, 432, 478
BmgT120I	GGNCC	2 cut(s)	359, 434
BmiI	GGNNCC	2 cut(s)	9, 561
BmrFI	CCNGG	3 cut(s)	357, 432, 478
BmsI	GCATC	2 cut(s)	274, 361
BplI	GAGNNNNNCTC	2 cut(s)	119, 151
BpmI	CTGGAG	1 cut(s)	46
Bpu10I	CCTNAGC	2 cut(s)	522, 620
Bpu1102I	GCTNAGC	1 cut(s)	375
BsaJI	CCNNGG	3 cut(s)	431, 476, 504
Bsc4I	CCNNNNNNNGG	2 cut(s)	207, 367
Bse1I	ACTGG	2 cut(s)	316, 554
BseBI	CCWGG	3 cut(s)	357, 432, 478
BseDI	CCNNGG	3 cut(s)	431, 476, 504
BseGI	GGATG	4 cut(s)	338, 376, 412, 550
BseLI	CCNNNNNNNGG	2 cut(s)	207, 367
BseMII	CTCAG	2 cut(s)	366, 536
BseNI	ACTGG	2 cut(s)	316, 554
BseRI	GAGGAG	2 cut(s)	71, 617
BseSI	GKGCMC	1 cut(s)	477
BseXI	GCAGC	1 cut(s)	588
BsgI	GTGCAG	1 cut(s)	618
BshFI	GGCC	2 cut(s)	360, 436
BslI	CCNNNNNNNGG	2 cut(s)	207, 367
BsnI	GGCC	2 cut(s)	360, 436
Bsp1286I	GDGCHC	1 cut(s)	477
Bsp143I	GATC	7 cut(s)	35, 65, 129, 152, 239, 293, 352
Bsp1720I	GCTNAGC	1 cut(s)	375
BspANI	GGCC	2 cut(s)	360, 436
BspCNI	CTCAG	2 cut(s)	367, 535
BspLI	GGNNCC	2 cut(s)	9, 561
BspPI	GGATC	3 cut(s)	60, 247, 347
BsrI	ACTGG	2 cut(s)	316, 554
BssECI	CCNNGG	3 cut(s)	431, 476, 504
BssMI	GATC	7 cut(s)	35, 65, 129, 152, 239, 293, 352
BssT1I	CCWWGG	1 cut(s)	504
Bst2UI	CCWGG	3 cut(s)	357, 432, 478
Bst6I	CTCTTC	2 cut(s)	243, 251
BstC8I	GCNNGC	1 cut(s)	637
BstDEI	CTNAG	5 cut(s)	95, 375, 522, 620, 650
BstF5I	GGATG	4 cut(s)	338, 376, 412, 550
BstKTI	GATC	7 cut(s)	38, 68, 132, 155, 242, 296, 355
BstMBI	GATC	7 cut(s)	35, 65, 129, 152, 239, 293, 352
BstNI	CCWGG	3 cut(s)	357, 432, 478
BstNSI	RCATGY	1 cut(s)	639
BstSCI	CCNGG	3 cut(s)	355, 430, 476
BstSLI	GKGCMC	1 cut(s)	477
BstV1I	GCAGC	1 cut(s)	588
BstX2I	RGATCY	3 cut(s)	65, 152, 293
BstYI	RGATCY	3 cut(s)	65, 152, 293
BsuI	GTATCC	1 cut(s)	382
BsuRI	GGCC	2 cut(s)	360, 436
BtsCI	GGATG	4 cut(s)	338, 376, 412, 550
BtsIMutI	CAGTG	2 cut(s)	309, 561
Cac8I	GCNNGC	1 cut(s)	637
Cfr13I	GGNCC	2 cut(s)	359, 434
CviAII	CATG	2 cut(s)	281, 636
CviJI	RGCY	9 cut(s)	224, 275, 360, 379, 436, 547, 619, 649, 675
CviKI_1	RGCY	9 cut(s)	224, 275, 360, 379, 436, 547, 619, 649, 675
DdeI	CTNAG	5 cut(s)	95, 375, 522, 620, 650
DpnI	GATC	7 cut(s)	37, 67, 131, 154, 241, 295, 354
DpnII	GATC	7 cut(s)	35, 65, 129, 152, 239, 293, 352
Eam1104I	CTCTTC	2 cut(s)	243, 251
EarI	CTCTTC	2 cut(s)	243, 251
Eco130I	CCWWGG	1 cut(s)	504
EcoRII	CCWGG	3 cut(s)	355, 430, 476
EcoT14I	CCWWGG	1 cut(s)	504
ErhI	CCWWGG	1 cut(s)	504
FaeI	CATG	2 cut(s)	284, 639
FaiI	YATR	8 cut(s)	121, 282, 335, 517, 519, 566, 637, 679
FalI	AAGNNNNNCTT	2 cut(s)	613, 645
FatI	CATG	2 cut(s)	280, 635
FblI	GTMKAC	1 cut(s)	626
Fnu4HI	GCNGC	1 cut(s)	577
FokI	GGATG	4 cut(s)	325, 383, 419, 537
Fsp4HI	GCNGC	1 cut(s)	577
FspBI	CTAG	1 cut(s)	291
GluI	GCNGC	1 cut(s)	577
GsuI	CTGGAG	1 cut(s)	46
HaeIII	GGCC	2 cut(s)	360, 436
Hin1II	CATG	2 cut(s)	284, 639
HincII	GTYRAC	1 cut(s)	627
HindII	GTYRAC	1 cut(s)	627
HindIII	AAGCTT	1 cut(s)	673
HinfI	GANTC	2 cut(s)	56, 134
HphI	GGTGA	2 cut(s)	52, 521
Hpy166II	GTNNAC	2 cut(s)	512, 627
Hpy188I	TCNGA	7 cut(s)	33, 152, 174, 202, 272, 352, 442
Hpy188III	TCNNGA	5 cut(s)	63, 181, 291, 485, 660
Hpy8I	GTNNAC	2 cut(s)	512, 627
HpyAV	CCTTC	1 cut(s)	95
HpyCH4IV	ACGT	2 cut(s)	104, 447
HpyCH4V	TGCA	1 cut(s)	599
HpyF3I	CTNAG	5 cut(s)	95, 375, 522, 620, 650
HpySE526I	ACGT	2 cut(s)	104, 447
Hsp92II	CATG	2 cut(s)	284, 639
Kzo9I	GATC	7 cut(s)	35, 65, 129, 152, 239, 293, 352
Lsp1109I	GCAGC	1 cut(s)	588
LweI	GCATC	2 cut(s)	274, 361
MaeI	CTAG	1 cut(s)	291
MaeII	ACGT	2 cut(s)	104, 447
MaeIII	GTNAC	2 cut(s)	40, 499
MalI	GATC	7 cut(s)	37, 67, 131, 154, 241, 295, 354
MboI	GATC	7 cut(s)	35, 65, 129, 152, 239, 293, 352
MboII	GAAGA	7 cut(s)	59, 215, 260, 265, 268, 288, 584
MfeI	CAATTG	1 cut(s)	164
MflI	RGATCY	3 cut(s)	65, 152, 293
MhlI	GDGCHC	1 cut(s)	477
MluCI	AATT	7 cut(s)	164, 196, 363, 400, 425, 567, 654
MlyI	GAGTC	2 cut(s)	65, 128
MmeI	TCCRAC	1 cut(s)	11
MnlI	CCTC	6 cut(s)	70, 92, 252, 298, 322, 595
MseI	TTAA	1 cut(s)	533
MspR9I	CCNGG	3 cut(s)	357, 432, 478
MunI	CAATTG	1 cut(s)	164
MvaI	CCWGG	3 cut(s)	357, 432, 478
NdeII	GATC	7 cut(s)	35, 65, 129, 152, 239, 293, 352
NlaIII	CATG	2 cut(s)	284, 639
NlaIV	GGNNCC	2 cut(s)	9, 561
NmuCI	GTSAC	2 cut(s)	40, 499
NspI	RCATGY	1 cut(s)	639
PaeI	GCATGC	1 cut(s)	639
PkrI	GCNGC	1 cut(s)	578
PleI	GAGTC	2 cut(s)	64, 128
PpsI	GAGTC	2 cut(s)	64, 128
Psp1406I	AACGTT	1 cut(s)	104
Psp6I	CCWGG	3 cut(s)	355, 430, 476
PspGI	CCWGG	3 cut(s)	355, 430, 476
PspN4I	GGNNCC	2 cut(s)	9, 561
PspPI	GGNCC	2 cut(s)	359, 434
PsuI	RGATCY	3 cut(s)	65, 152, 293
SalI	GTCGAC	1 cut(s)	625
SaqAI	TTAA	1 cut(s)	533
SatI	GCNGC	1 cut(s)	577
Sau3AI	GATC	7 cut(s)	35, 65, 129, 152, 239, 293, 352
Sau96I	GGNCC	2 cut(s)	359, 434
SchI	GAGTC	2 cut(s)	65, 128
ScrFI	CCNGG	3 cut(s)	357, 432, 478
SduI	GDGCHC	1 cut(s)	477
SfaNI	GCATC	2 cut(s)	274, 361
SphI	GCATGC	1 cut(s)	639
Sse9I	AATT	7 cut(s)	164, 196, 363, 400, 425, 567, 654
SspMI	CTAG	1 cut(s)	291
StyD4I	CCNGG	3 cut(s)	355, 430, 476
StyI	CCWWGG	1 cut(s)	504
TaiI	ACGT	2 cut(s)	107, 450
TaqI	TCGA	4 cut(s)	100, 132, 189, 626
TasI	AATT	7 cut(s)	164, 196, 363, 400, 425, 567, 654
Tru1I	TTAA	1 cut(s)	533
Tru9I	TTAA	1 cut(s)	533
TscAI	CASTG	2 cut(s)	316, 561
TseFI	GTSAC	2 cut(s)	40, 499
TseI	GCWGC	1 cut(s)	576
Tsp45I	GTSAC	2 cut(s)	40, 499
TspDTI	ATGAA	2 cut(s)	256, 632
TspRI	CASTG	2 cut(s)	316, 561
XapI	RAATTY	2 cut(s)	196, 654
XbaI	TCTAGA	1 cut(s)	290
XceI	RCATGY	1 cut(s)	639
XcmI	CCANNNNNNNNNTGG	1 cut(s)	363
XmiI	GTMKAC	1 cut(s)	626
XspI	CTAG	1 cut(s)	291

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.