Rmu_sc0004823.1_g000009

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004823.1
OG0025586
Physical Location & Seq
Forward (+)
25117 .. 27178
2062 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 666 bp
atgtaccagaagatcaaaaactccggtggtggttttgaggctcctggaggtttcctcaaggaagtgtcattgcatgatgtgaggttggatccaacttcacaatatgggaagacacagcaaacaaatctgaagtacatgttgatgttggattctgatagtttaattactttggagctttcgaaagacagctggatgagtaacttgaacaaattggactttgctccattaaggacaactggctctggatatcacaaccaggacgagctaactattgagcaagctcaagctttggaagcaaatagagaaaccttggaggcaaataaggtgaaagcagtcatcctaatgactcgtcatgtggatgatttactcctgtacgagtatctgaatgaagaagacctcagaaggttgtgggtctcactcaaagaaagatttggcaacgtccgtgactccctacttcctgacctagaagtaagatggcatagcctctgcttctgtgatttcaaagcagttcttgactacaacttggaagcatttcacattaaatccttaatgaaattctatggaaaatatatcatagatgtgatgttgattgagaagactttctctaccatccccgtctctactttgatggttgctaagaactatcaaatcgatattactgcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

221

Amino Acids

25.5

Weight (kDa)

5.42

Isoelectric Point (pI)

43.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025586)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8309493.1_g000001 Rmu_sc0004823.1_g000009 Rmu_sc0010318.1_g000003

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 83, 96
AcsI RAATTY 1 cut(s) 554
AcuI CTGAAG 1 cut(s) 149
AfaI GTAC 3 cut(s) 5, 134, 374
AflIII ACRYGT 1 cut(s) 135
AgsI TTSAA 2 cut(s) 205, 502
AjnI CCWGG 2 cut(s) 43, 255
AluBI AGCT 5 cut(s) 175, 189, 265, 281, 287
AluI AGCT 5 cut(s) 175, 189, 265, 281, 287
Alw26I GTCTC 2 cut(s) 418, 622
AlwI GGATC 2 cut(s) 83, 96
ApoI RAATTY 1 cut(s) 554
Asp700I GAANNNNTTC 2 cut(s) 531, 599
AsuHPI GGTGA 1 cut(s) 337
AsuII TTCGAA 1 cut(s) 179
BamHI GGATCC 1 cut(s) 88
BbsI GAAGAC 3 cut(s) 116, 399, 602
BccI CCATC 3 cut(s) 468, 617, 622
BcgI CGANNNNNNTGC 1 cut(s) 641
BciT130I CCWGG 2 cut(s) 45, 257
BcoDI GTCTC 2 cut(s) 418, 622
BfaI CTAG 1 cut(s) 464
Bme1390I CCNGG 2 cut(s) 45, 257
BmiI GGNNCC 2 cut(s) 42, 90
BmrFI CCNGG 2 cut(s) 45, 257
BpiI GAAGAC 3 cut(s) 116, 399, 602
BplI GAGNNNNNCTC 2 cut(s) 39, 71
BpmI CTGGAG 1 cut(s) 66
Bpu14I TTCGAA 1 cut(s) 179
BpuEI CTTGAG 2 cut(s) 41, 267
Bsa29I ATCGAT 1 cut(s) 651
BsaI GGTCTC 1 cut(s) 418
BsaJI CCNNGG 1 cut(s) 309
BsaWI WCCGGW 1 cut(s) 23
Bse1I ACTGG 1 cut(s) 241
Bse3DI GCAATG 1 cut(s) 68
BseBI CCWGG 2 cut(s) 45, 257
BseCI ATCGAT 1 cut(s) 651
BseDI CCNNGG 1 cut(s) 309
BseGI GGATG 4 cut(s) 198, 336, 364, 609
BseMI GCAATG 1 cut(s) 68
BseMII CTCAG 1 cut(s) 412
BseNI ACTGG 1 cut(s) 241
BshVI ATCGAT 1 cut(s) 651
BsiSI CCGG 1 cut(s) 24
BsmAI GTCTC 2 cut(s) 418, 622
BsmBI CGTCTC 1 cut(s) 622
Bso31I GGTCTC 1 cut(s) 418
Bsp119I TTCGAA 1 cut(s) 179
Bsp143I GATC 2 cut(s) 12, 88
BspCNI CTCAG 1 cut(s) 411
BspDI ATCGAT 1 cut(s) 651
BspLI GGNNCC 2 cut(s) 42, 90
BspPI GGATC 2 cut(s) 83, 96
BspT104I TTCGAA 1 cut(s) 179
BspTNI GGTCTC 1 cut(s) 418
BsrDI GCAATG 1 cut(s) 68
BsrI ACTGG 1 cut(s) 241
BssECI CCNNGG 1 cut(s) 309
BssMI GATC 2 cut(s) 12, 88
BssT1I CCWWGG 1 cut(s) 309
Bst2UI CCWGG 2 cut(s) 45, 257
BstBI TTCGAA 1 cut(s) 179
BstC8I GCNNGC 1 cut(s) 279
BstDEI CTNAG 2 cut(s) 398, 636
BstF5I GGATG 4 cut(s) 198, 336, 364, 609
BstKTI GATC 2 cut(s) 15, 91
BstMAI GTCTC 2 cut(s) 418, 622
BstMBI GATC 2 cut(s) 12, 88
BstMWI GCNNNNNNNGC 1 cut(s) 293
BstNI CCWGG 2 cut(s) 45, 257
BstNSI RCATGY 1 cut(s) 139
BstSCI CCNGG 2 cut(s) 43, 255
BstV2I GAAGAC 3 cut(s) 116, 399, 602
BstX2I RGATCY 1 cut(s) 88
BstYI RGATCY 1 cut(s) 88
Bsu15I ATCGAT 1 cut(s) 651
BsuTUI ATCGAT 1 cut(s) 651
BtsCI GGATG 4 cut(s) 198, 336, 364, 609
Cac8I GCNNGC 1 cut(s) 279
ClaI ATCGAT 1 cut(s) 651
Csp6I GTAC 3 cut(s) 4, 133, 373
CviAII CATG 4 cut(s) 74, 136, 353, 663
CviJI RGCY 8 cut(s) 41, 175, 189, 240, 265, 281, 287, 483
CviKI_1 RGCY 8 cut(s) 41, 175, 189, 240, 265, 281, 287, 483
CviQI GTAC 3 cut(s) 4, 133, 373
DdeI CTNAG 2 cut(s) 398, 636
DpnI GATC 2 cut(s) 14, 90
DpnII GATC 2 cut(s) 12, 88
Eco130I CCWWGG 1 cut(s) 309
Eco31I GGTCTC 1 cut(s) 418
Eco32I GATATC 1 cut(s) 248
Eco57I CTGAAG 1 cut(s) 149
EcoRII CCWGG 2 cut(s) 43, 255
EcoRV GATATC 1 cut(s) 248
EcoT14I CCWWGG 1 cut(s) 309
ErhI CCWWGG 1 cut(s) 309
Esp3I CGTCTC 1 cut(s) 622
FaeI CATG 4 cut(s) 77, 139, 356, 666
FaiI YATR 9 cut(s) 75, 105, 137, 354, 480, 561, 570, 575, 664
FalI AAGNNNNNCTT 2 cut(s) 495, 527
FatI CATG 4 cut(s) 73, 135, 352, 662
FokI GGATG 4 cut(s) 205, 323, 371, 596
FspBI CTAG 1 cut(s) 464
GsuI CTGGAG 1 cut(s) 66
HapII CCGG 1 cut(s) 24
Hin1II CATG 4 cut(s) 77, 139, 356, 666
HindIII AAGCTT 1 cut(s) 285
HinfI GANTC 3 cut(s) 149, 346, 446
HpaII CCGG 1 cut(s) 24
HphI GGTGA 1 cut(s) 337
Hpy188I TCNGA 4 cut(s) 129, 154, 384, 401
Hpy188III TCNNGA 3 cut(s) 243, 458, 512
HpyAV CCTTC 1 cut(s) 396
HpyCH4IV ACGT 1 cut(s) 438
HpyCH4V TGCA 2 cut(s) 73, 662
HpyF10VI GCNNNNNNNGC 1 cut(s) 293
HpyF3I CTNAG 2 cut(s) 398, 636
HpySE526I ACGT 1 cut(s) 438
Hsp92II CATG 4 cut(s) 77, 139, 356, 666
Kzo9I GATC 2 cut(s) 12, 88
LmnI GCTCC 3 cut(s) 46, 172, 226
MaeI CTAG 1 cut(s) 464
MaeII ACGT 1 cut(s) 438
MaeIII GTNAC 2 cut(s) 197, 443
MalI GATC 2 cut(s) 14, 90
MboI GATC 2 cut(s) 12, 88
MboII GAAGA 5 cut(s) 22, 121, 401, 404, 607
MflI RGATCY 1 cut(s) 88
MluCI AATT 3 cut(s) 162, 209, 554
MlyI GAGTC 2 cut(s) 340, 440
MmeI TCCRAC 3 cut(s) 66, 116, 126
MnlI CCTC 7 cut(s) 31, 41, 65, 75, 307, 407, 494
MroXI GAANNNNTTC 2 cut(s) 531, 599
MseI TTAA 4 cut(s) 161, 227, 540, 548
MslI CAYNNNNRTG 4 cut(s) 140, 341, 357, 578
MspA1I CMGCKG 1 cut(s) 189
MspI CCGG 1 cut(s) 24
MspR9I CCNGG 2 cut(s) 45, 257
MvaI CCWGG 2 cut(s) 45, 257
MwoI GCNNNNNNNGC 1 cut(s) 293
NdeII GATC 2 cut(s) 12, 88
NlaIII CATG 4 cut(s) 77, 139, 356, 666
NlaIV GGNNCC 2 cut(s) 42, 90
NmuCI GTSAC 1 cut(s) 443
NspI RCATGY 1 cut(s) 139
NspV TTCGAA 1 cut(s) 179
PciI ACATGT 1 cut(s) 135
PdmI GAANNNNTTC 2 cut(s) 531, 599
PfeI GAWTC 1 cut(s) 149
PfoI TCCNGGA 1 cut(s) 43
PleI GAGTC 2 cut(s) 340, 440
PpsI GAGTC 2 cut(s) 340, 440
PscI ACATGT 1 cut(s) 135
Psp6I CCWGG 2 cut(s) 43, 255
PspGI CCWGG 2 cut(s) 43, 255
PspN4I GGNNCC 2 cut(s) 42, 90
PsuI RGATCY 1 cut(s) 88
PvuII CAGCTG 1 cut(s) 189
RsaI GTAC 3 cut(s) 5, 134, 374
RsaNI GTAC 3 cut(s) 4, 133, 373
RseI CAYNNNNRTG 4 cut(s) 140, 341, 357, 578
SaqAI TTAA 4 cut(s) 161, 227, 540, 548
Sau3AI GATC 2 cut(s) 12, 88
SchI GAGTC 2 cut(s) 340, 440
ScrFI CCNGG 2 cut(s) 45, 257
SfuI TTCGAA 1 cut(s) 179
SmiMI CAYNNNNRTG 4 cut(s) 140, 341, 357, 578
SmlI CTYRAG 2 cut(s) 56, 282
SmoI CTYRAG 2 cut(s) 56, 282
Sse9I AATT 3 cut(s) 162, 209, 554
SspMI CTAG 1 cut(s) 464
StyD4I CCNGG 2 cut(s) 43, 255
StyI CCWWGG 1 cut(s) 309
TaiI ACGT 1 cut(s) 441
TaqI TCGA 2 cut(s) 179, 651
TasI AATT 3 cut(s) 162, 209, 554
TatI WGTACW 1 cut(s) 132
TfiI GAWTC 1 cut(s) 149
Tru1I TTAA 4 cut(s) 161, 227, 540, 548
Tru9I TTAA 4 cut(s) 161, 227, 540, 548
TseFI GTSAC 1 cut(s) 443
Tsp45I GTSAC 1 cut(s) 443
TspDTI ATGAA 2 cut(s) 402, 566
TspGWI ACGGA 1 cut(s) 431
XapI RAATTY 1 cut(s) 554
XceI RCATGY 1 cut(s) 139
XmnI GAANNNNTTC 2 cut(s) 531, 599
XspI CTAG 1 cut(s) 464
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.