Rmu_sc0004860.1_g000008

Belongs to the glycosyl hydrolase 1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004860.1
N/A
Physical Location & Seq
Forward (+)
41321 .. 46732
5412 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 786 bp
atggaaagggtccatgccgcagagagagaacccgtgggctggaggctgaagaggactggaggagcagtggagtggaggggcgcggtggaacagagggagactgaggcagagtcgcgcaaagagagagagtcgtggtggcacagcgaagcggaggcccgacgctggaggcacgctgctgtggatgctgagagcttgcaggccaatgcatcagaccctgaagaattgaacgtgaagttcgtggaaccaccagtatacggagattatccaaagactatgagagatttggtcaaggaattaaggctaccctgtttcactgaagaagagaaaagcttagtcaagggatccttcgatttcattggcatcaactataattccacaagatatggtaaaaacgttccagcaagtgaagctaaaccaatcaatggtgctttggctatatcgagtgaaacgatgcttggggatcctagcactagtttgaggggggatgttaagagtatagtacagaatcaaggtaataaggattgcagattgtctacacgtgttgaggatctgatggagagaaagaaagttagttggaatggggtgaacgtcaaaggatatttccactgggctctattcgacgactgggagtgggtggaaggctatactccaaggttcgggctttactacgttgaccataaagacaatctcaagcgcattcataaagaatctgctaagtggcttccattgttcttaaaggacataagctctacatggttgttccagaagcagattttccttgagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00460 ko00500 ko00940 ko01100 ko01110 map00460 map00500 map00940 map01100 map01110
Pfam Domains
Protein Families
Glyco_hydro_1

Protein Analysis

261

Amino Acids

30.31

Weight (kDa)

6.36

Isoelectric Point (pI)

36.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_1 PF00232 63 - 140 7.6e-10 Glycosyl hydrolase family 1
Glyco_hydro_1 PF00232 167 - 241 1.7e-16 Glycosyl hydrolase family 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 422
AccI GTMKAC 2 cut(s) 252, 533
AccII CGCG 2 cut(s) 83, 115
AciI CCGC 3 cut(s) 18, 83, 149
AclI AACGTT 1 cut(s) 393
AclWI GGATC 5 cut(s) 336, 349, 455, 468, 555
AcuI CTGAAG 3 cut(s) 68, 237, 336
AcvI CACGTG 1 cut(s) 539
AfaI GTAC 1 cut(s) 501
AfiI CCNNNNNNNGG 5 cut(s) 39, 162, 254, 422, 656
AflIII ACRYGT 2 cut(s) 536, 538
AgsI TTSAA 1 cut(s) 226
AhlI ACTAGT 1 cut(s) 470
AjuI GAANNNNNNNTTGG 2 cut(s) 438, 470
AluBI AGCT 4 cut(s) 192, 330, 410, 747
AluI AGCT 4 cut(s) 192, 330, 410, 747
Alw26I GTCTC 1 cut(s) 92
AlwI GGATC 5 cut(s) 336, 349, 455, 468, 555
AlwNI CAGNNNCTG 1 cut(s) 215
AoxI GGCC 2 cut(s) 153, 198
ApeKI GCWGC 1 cut(s) 173
AspLEI GCGC 3 cut(s) 83, 117, 696
AspS9I GGNCC 2 cut(s) 10, 154
AsuHPI GGTGA 1 cut(s) 595
AvaII GGWCC 1 cut(s) 10
BamHI GGATCC 2 cut(s) 341, 460
BanII GRGCYC 1 cut(s) 613
BbrPI CACGTG 1 cut(s) 539
BbvI GCAGC 1 cut(s) 160
BccI CCATC 1 cut(s) 547
BcoDI GTCTC 1 cut(s) 92
BcuI ACTAGT 1 cut(s) 470
BfaI CTAG 2 cut(s) 465, 471
BisI GCNGC 2 cut(s) 18, 174
BlsI GCNGC 2 cut(s) 19, 175
Bme18I GGWCC 1 cut(s) 10
BmgT120I GGNCC 2 cut(s) 10, 154
BmiI GGNNCC 4 cut(s) 11, 243, 343, 462
BmrI ACTGGG 2 cut(s) 616, 634
BmsI GCATC 4 cut(s) 172, 215, 369, 441
BmuI ACTGGG 2 cut(s) 616, 634
BpmI CTGGAG 3 cut(s) 61, 78, 184
BpuEI CTTGAG 1 cut(s) 674
BsaAI YACGTR 1 cut(s) 539
BsaJI CCNNGG 2 cut(s) 33, 650
BsaXI ACNNNNNCTCC 2 cut(s) 51, 81
Bsc4I CCNNNNNNNGG 5 cut(s) 39, 162, 254, 422, 656
Bse1I ACTGG 4 cut(s) 61, 248, 611, 629
BseDI CCNNGG 2 cut(s) 33, 650
BseGI GGATG 2 cut(s) 187, 490
BseLI CCNNNNNNNGG 5 cut(s) 39, 162, 254, 422, 656
BseMII CTCAG 2 cut(s) 93, 177
BseNI ACTGG 4 cut(s) 61, 248, 611, 629
BseRI GAGGAG 1 cut(s) 75
BseXI GCAGC 1 cut(s) 160
Bsh1236I CGCG 2 cut(s) 83, 115
BshFI GGCC 2 cut(s) 155, 200
BslI CCNNNNNNNGG 5 cut(s) 39, 162, 254, 422, 656
BsmAI GTCTC 1 cut(s) 92
BsmI GAATGC 1 cut(s) 696
BsnI GGCC 2 cut(s) 155, 200
Bsp1286I GDGCHC 1 cut(s) 613
Bsp143I GATC 3 cut(s) 341, 460, 547
BspACI CCGC 3 cut(s) 18, 83, 149
BspANI GGCC 2 cut(s) 155, 200
BspCNI CTCAG 2 cut(s) 94, 178
BspFNI CGCG 2 cut(s) 83, 115
BspLI GGNNCC 4 cut(s) 11, 243, 343, 462
BspPI GGATC 5 cut(s) 336, 349, 455, 468, 555
BsrI ACTGG 4 cut(s) 61, 248, 611, 629
BssECI CCNNGG 2 cut(s) 33, 650
BssMI GATC 3 cut(s) 341, 460, 547
BssNAI GTATAC 1 cut(s) 253
BssT1I CCWWGG 1 cut(s) 650
Bst1107I GTATAC 1 cut(s) 253
Bst6I CTCTTC 2 cut(s) 44, 315
BstBAI YACGTR 1 cut(s) 539
BstC8I GCNNGC 3 cut(s) 171, 194, 198
BstDEI CTNAG 4 cut(s) 102, 186, 331, 714
BstDSI CCRYGG 1 cut(s) 33
BstF5I GGATG 2 cut(s) 187, 490
BstFNI CGCG 2 cut(s) 83, 115
BstHHI GCGC 3 cut(s) 83, 117, 696
BstKTI GATC 3 cut(s) 344, 463, 550
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 3 cut(s) 341, 460, 547
BstMWI GCNNNNNNNGC 2 cut(s) 182, 407
BstUI CGCG 2 cut(s) 83, 115
BstV1I GCAGC 1 cut(s) 160
BstX2I RGATCY 3 cut(s) 341, 460, 547
BstYI RGATCY 3 cut(s) 341, 460, 547
BstZ17I GTATAC 1 cut(s) 253
BsuRI GGCC 2 cut(s) 155, 200
BtgI CCRYGG 1 cut(s) 33
BtsCI GGATG 2 cut(s) 187, 490
BtsI GCAGTG 1 cut(s) 72
BtsIMutI CAGTG 3 cut(s) 72, 312, 604
Cac8I GCNNGC 3 cut(s) 171, 194, 198
CaiI CAGNNNCTG 1 cut(s) 215
CfoI GCGC 3 cut(s) 83, 117, 696
Cfr13I GGNCC 2 cut(s) 10, 154
CseI GACGC 1 cut(s) 168
Csp6I GTAC 1 cut(s) 500
CviAII CATG 2 cut(s) 14, 753
CviQI GTAC 1 cut(s) 500
DdeI CTNAG 4 cut(s) 102, 186, 331, 714
DpnI GATC 3 cut(s) 343, 462, 549
DpnII GATC 3 cut(s) 341, 460, 547
Eam1104I CTCTTC 2 cut(s) 44, 315
EarI CTCTTC 2 cut(s) 44, 315
Eco130I CCWWGG 1 cut(s) 650
Eco24I GRGCYC 1 cut(s) 613
Eco47I GGWCC 1 cut(s) 10
Eco57I CTGAAG 3 cut(s) 68, 237, 336
Eco72I CACGTG 1 cut(s) 539
EcoT14I CCWWGG 1 cut(s) 650
EcoT22I ATGCAT 1 cut(s) 208
EcoT38I GRGCYC 1 cut(s) 613
ErhI CCWWGG 1 cut(s) 650
FaeI CATG 2 cut(s) 17, 756
FalI AAGNNNNNCTT 2 cut(s) 329, 361
FatI CATG 2 cut(s) 13, 752
FblI GTMKAC 2 cut(s) 252, 533
Fnu4HI GCNGC 2 cut(s) 18, 174
FokI GGATG 2 cut(s) 194, 497
FriOI GRGCYC 1 cut(s) 613
Fsp4HI GCNGC 2 cut(s) 18, 174
FspBI CTAG 2 cut(s) 465, 471
GlaI GCGC 3 cut(s) 82, 116, 695
GluI GCNGC 2 cut(s) 18, 174
GsuI CTGGAG 3 cut(s) 61, 78, 184
HaeIII GGCC 2 cut(s) 155, 200
HgaI GACGC 1 cut(s) 168
HhaI GCGC 3 cut(s) 83, 117, 696
Hin1II CATG 2 cut(s) 17, 756
Hin6I GCGC 3 cut(s) 81, 115, 694
HinP1I GCGC 3 cut(s) 81, 115, 694
HincII GTYRAC 1 cut(s) 673
HindII GTYRAC 1 cut(s) 673
HindIII AAGCTT 1 cut(s) 328
HinfI GANTC 4 cut(s) 110, 128, 505, 707
HphI GGTGA 1 cut(s) 595
Hpy166II GTNNAC 4 cut(s) 253, 534, 586, 673
Hpy188I TCNGA 2 cut(s) 211, 552
Hpy188III TCNNGA 1 cut(s) 763
Hpy8I GTNNAC 4 cut(s) 253, 534, 586, 673
Hpy99I CGWCG 2 cut(s) 162, 623
HpyAV CCTTC 2 cut(s) 355, 632
HpyCH4IV ACGT 5 cut(s) 228, 393, 538, 588, 669
HpyCH4V TGCA 3 cut(s) 196, 206, 525
HpyF10VI GCNNNNNNNGC 2 cut(s) 182, 407
HpyF3I CTNAG 4 cut(s) 102, 186, 331, 714
HpySE526I ACGT 5 cut(s) 228, 393, 538, 588, 669
Hsp92II CATG 2 cut(s) 17, 756
HspAI GCGC 3 cut(s) 81, 115, 694
Kzo9I GATC 3 cut(s) 341, 460, 547
LmnI GCTCC 1 cut(s) 62
Lsp1109I GCAGC 1 cut(s) 160
LweI GCATC 4 cut(s) 172, 215, 369, 441
MaeI CTAG 2 cut(s) 465, 471
MaeII ACGT 5 cut(s) 228, 393, 538, 588, 669
MalI GATC 3 cut(s) 343, 462, 549
MboI GATC 3 cut(s) 341, 460, 547
MboII GAAGA 4 cut(s) 61, 230, 329, 332
MflI RGATCY 3 cut(s) 341, 460, 547
MhlI GDGCHC 1 cut(s) 613
MluCI AATT 3 cut(s) 221, 293, 370
MlyI GAGTC 2 cut(s) 119, 137
MmeI TCCRAC 1 cut(s) 554
Mph1103I ATGCAT 1 cut(s) 208
MseI TTAA 3 cut(s) 296, 489, 734
Mva1269I GAATGC 1 cut(s) 696
MvnI CGCG 2 cut(s) 83, 115
MwoI GCNNNNNNNGC 2 cut(s) 182, 407
NdeII GATC 3 cut(s) 341, 460, 547
NlaIII CATG 2 cut(s) 17, 756
NlaIV GGNNCC 4 cut(s) 11, 243, 343, 462
NsiI ATGCAT 1 cut(s) 208
PcsI WCGNNNNNNNCGW 2 cut(s) 234, 446
PctI GAATGC 1 cut(s) 696
PfeI GAWTC 2 cut(s) 505, 707
PflMI CCANNNNNTGG 1 cut(s) 422
PkrI GCNGC 2 cut(s) 19, 175
PleI GAGTC 2 cut(s) 118, 136
PmaCI CACGTG 1 cut(s) 539
PmlI CACGTG 1 cut(s) 539
PpsI GAGTC 2 cut(s) 118, 136
Ppu21I YACGTR 1 cut(s) 539
Psp1406I AACGTT 1 cut(s) 393
PspCI CACGTG 1 cut(s) 539
PspN4I GGNNCC 4 cut(s) 11, 243, 343, 462
PspPI GGNCC 2 cut(s) 10, 154
PstNI CAGNNNCTG 1 cut(s) 215
PsuI RGATCY 3 cut(s) 341, 460, 547
RsaI GTAC 1 cut(s) 501
RsaNI GTAC 1 cut(s) 500
SaqAI TTAA 3 cut(s) 296, 489, 734
SatI GCNGC 2 cut(s) 18, 174
Sau3AI GATC 3 cut(s) 341, 460, 547
Sau96I GGNCC 2 cut(s) 10, 154
SchI GAGTC 2 cut(s) 119, 137
SduI GDGCHC 1 cut(s) 613
SfaNI GCATC 4 cut(s) 172, 215, 369, 441
SinI GGWCC 1 cut(s) 10
SmlI CTYRAG 2 cut(s) 689, 779
SmoI CTYRAG 2 cut(s) 689, 779
SpeI ACTAGT 1 cut(s) 470
Sse9I AATT 3 cut(s) 221, 293, 370
SsiI CCGC 3 cut(s) 18, 83, 149
SspMI CTAG 2 cut(s) 465, 471
StyI CCWWGG 1 cut(s) 650
TaiI ACGT 5 cut(s) 231, 396, 541, 591, 672
TaqI TCGA 3 cut(s) 348, 440, 618
TasI AATT 3 cut(s) 221, 293, 370
TatI WGTACW 1 cut(s) 499
TauI GCSGC 1 cut(s) 20
TfiI GAWTC 2 cut(s) 505, 707
Tru1I TTAA 3 cut(s) 296, 489, 734
Tru9I TTAA 3 cut(s) 296, 489, 734
TscAI CASTG 3 cut(s) 72, 319, 611
TseI GCWGC 1 cut(s) 173
TspDTI ATGAA 2 cut(s) 343, 689
TspGWI ACGGA 1 cut(s) 270
TspRI CASTG 3 cut(s) 72, 319, 611
Van91I CCANNNNNTGG 1 cut(s) 422
VpaK11BI GGWCC 1 cut(s) 10
XmiI GTMKAC 2 cut(s) 252, 533
XspI CTAG 2 cut(s) 465, 471
Zsp2I ATGCAT 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.