Rmu_sc0004908.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004908.1
N/A
Physical Location & Seq
Forward (+)
44751 .. 48209
3459 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 801 bp
atggtgggcgttgccggacagggcgatgggatggttggctctgccttggtggaaggatttggttcttttggcttgaggggatttaggcggcagcagcagtttcctctttaccttcagacgacggcgggtggtggatgggcaagcttcacgccggggtggaaaggggcagaaaggttgagagtcaaagccttcgatcaagccccgcccgcacggcctcgcctgcgtagatcccagcagccacagcccggcctcgacatccctccagaccggcctctaacctgctctacccgcctgacagcagctccggaaactgcatttgggtcaaaagactacactgccaccatccaaactcccactgaccccaaagacgatggaccgtctaataaggggaaagcaaatgccttaatgtttctgaggcgacatattgatcctagcttacgctgggaataccttcagttgaagacacccaaagaactgtgggatgctcttaagggacgttttgggaacattcatgacaccttgctcccagaactaaccgttaagtggaatgaaatccgcttacttgactacaaaaaggttaatgacttcaacaaggacatgttgcgcctaaaggcacgtctaaatttctgtggaaagaaactcacagaagataatatgatccagaagactctttccacttttcctacttcagcaattatactagcgaaccagtataggctggagtatgataacaaacgaatcacaactttcaataagctgatcaaccgcaagtggctgagaggcataatgaggttcttttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

266

Amino Acids

30.29

Weight (kDa)

10.12

Isoelectric Point (pI)

50.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 287
AccIII TCCGGA 1 cut(s) 304
AciI CCGC 7 cut(s) 88, 125, 203, 207, 289, 556, 766
AclWI GGATC 3 cut(s) 222, 422, 652
AcsI RAATTY 1 cut(s) 622
AcuI CTGAAG 3 cut(s) 98, 437, 672
AfiI CCNNNNNNNGG 2 cut(s) 245, 543
AflII CTTAAG 1 cut(s) 488
AflIII ACRYGT 1 cut(s) 597
AgsI TTSAA 3 cut(s) 460, 589, 751
AjiI CACGTC 1 cut(s) 617
AjuI GAANNNNNNNTTGG 2 cut(s) 300, 332
AluBI AGCT 4 cut(s) 144, 302, 435, 757
AluI AGCT 4 cut(s) 144, 302, 435, 757
AlwI GGATC 3 cut(s) 222, 422, 652
Aor13HI TCCGGA 1 cut(s) 304
AoxI GGCC 3 cut(s) 212, 247, 269
ApeKI GCWGC 4 cut(s) 91, 94, 235, 299
ApoI RAATTY 1 cut(s) 622
Asp700I GAANNNNTTC 1 cut(s) 450
AspLEI GCGC 1 cut(s) 606
AspS9I GGNCC 1 cut(s) 374
AsuC2I CCSGG 2 cut(s) 153, 246
AvaII GGWCC 1 cut(s) 374
BbsI GAAGAC 2 cut(s) 467, 671
BbvI GCAGC 4 cut(s) 103, 106, 247, 311
BccI CCATC 5 cut(s) 20, 25, 129, 350, 365
BceAI ACGGC 2 cut(s) 138, 227
BclI TGATCA 1 cut(s) 759
BcnI CCSGG 2 cut(s) 153, 246
BfaI CTAG 2 cut(s) 432, 701
BfrI CTTAAG 1 cut(s) 488
BfuAI ACCTGC 1 cut(s) 287
BglI GCCNNNNNGGC 1 cut(s) 211
BisI GCNGC 5 cut(s) 89, 92, 95, 236, 300
BlsI GCNGC 5 cut(s) 90, 93, 96, 237, 301
Bme1390I CCNGG 2 cut(s) 153, 246
Bme18I GGWCC 1 cut(s) 374
BmgBI CACGTC 1 cut(s) 617
BmgT120I GGNCC 1 cut(s) 374
BmrFI CCNGG 2 cut(s) 153, 246
BmsI GCATC 1 cut(s) 472
BpiI GAAGAC 2 cut(s) 467, 671
BpmI CTGGAG 2 cut(s) 246, 740
BpuEI CTTGAG 1 cut(s) 94
BpuMI CCSGG 2 cut(s) 153, 246
BsaJI CCNNGG 2 cut(s) 45, 152
BsaWI WCCGGW 1 cut(s) 304
BsaXI ACNNNNNCTCC 2 cut(s) 286, 316
Bsc4I CCNNNNNNNGG 2 cut(s) 245, 543
Bse118I RCCGGY 1 cut(s) 267
Bse1I ACTGG 1 cut(s) 709
BseAI TCCGGA 1 cut(s) 304
BseDI CCNNGG 2 cut(s) 45, 152
BseGI GGATG 5 cut(s) 36, 140, 255, 342, 487
BseLI CCNNNNNNNGG 2 cut(s) 245, 543
BseMII CTCAG 2 cut(s) 404, 767
BseNI ACTGG 1 cut(s) 709
BseXI GCAGC 4 cut(s) 103, 106, 247, 311
BseYI CCCAGC 2 cut(s) 231, 441
BshFI GGCC 3 cut(s) 214, 249, 271
BsiSI CCGG 5 cut(s) 15, 152, 246, 268, 305
BslFI GGGAC 1 cut(s) 507
BslI CCNNNNNNNGG 2 cut(s) 245, 543
BsmFI GGGAC 1 cut(s) 507
BsnI GGCC 3 cut(s) 214, 249, 271
Bsp13I TCCGGA 1 cut(s) 304
Bsp143I GATC 5 cut(s) 193, 227, 427, 657, 759
BspACI CCGC 7 cut(s) 88, 125, 203, 207, 289, 556, 766
BspANI GGCC 3 cut(s) 214, 249, 271
BspCNI CTCAG 2 cut(s) 405, 768
BspEI TCCGGA 1 cut(s) 304
BspHI TCATGA 1 cut(s) 511
BspMI ACCTGC 1 cut(s) 287
BspPI GGATC 3 cut(s) 222, 422, 652
BspTI CTTAAG 1 cut(s) 488
BsrFI RCCGGY 1 cut(s) 267
BsrI ACTGG 1 cut(s) 709
BssAI RCCGGY 1 cut(s) 267
BssECI CCNNGG 2 cut(s) 45, 152
BssMI GATC 5 cut(s) 193, 227, 427, 657, 759
BssT1I CCWWGG 1 cut(s) 45
Bst4CI ACNGT 3 cut(s) 378, 477, 538
BstAFI CTTAAG 1 cut(s) 488
BstC8I GCNNGC 3 cut(s) 142, 207, 221
BstDEI CTNAG 2 cut(s) 413, 776
BstF5I GGATG 5 cut(s) 36, 140, 255, 342, 487
BstHHI GCGC 1 cut(s) 606
BstKTI GATC 5 cut(s) 196, 230, 430, 660, 762
BstMBI GATC 5 cut(s) 193, 227, 427, 657, 759
BstMWI GCNNNNNNNGC 6 cut(s) 94, 206, 211, 220, 241, 288
BstNSI RCATGY 1 cut(s) 601
BstSCI CCNGG 2 cut(s) 151, 244
BstV1I GCAGC 4 cut(s) 103, 106, 247, 311
BstV2I GAAGAC 2 cut(s) 467, 671
BstX2I RGATCY 1 cut(s) 227
BstYI RGATCY 1 cut(s) 227
BsuRI GGCC 3 cut(s) 214, 249, 271
BtgZI GCGATG 1 cut(s) 39
BtrI CACGTC 1 cut(s) 617
BtsCI GGATG 5 cut(s) 36, 140, 255, 342, 487
BtsI GCAGTG 1 cut(s) 333
BtsIMutI CAGTG 2 cut(s) 333, 354
BveI ACCTGC 1 cut(s) 287
Cac8I GCNNGC 3 cut(s) 142, 207, 221
CciI TCATGA 1 cut(s) 511
CfoI GCGC 1 cut(s) 606
Cfr10I RCCGGY 1 cut(s) 267
Cfr13I GGNCC 1 cut(s) 374
CviAII CATG 2 cut(s) 512, 598
DdeI CTNAG 2 cut(s) 413, 776
DpnI GATC 5 cut(s) 195, 229, 429, 659, 761
DpnII GATC 5 cut(s) 193, 227, 427, 657, 759
Eco130I CCWWGG 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 374
Eco57I CTGAAG 3 cut(s) 98, 437, 672
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 2 cut(s) 515, 601
FaiI YATR 8 cut(s) 423, 513, 599, 656, 698, 714, 726, 785
FaqI GGGAC 1 cut(s) 507
FatI CATG 2 cut(s) 511, 597
FauI CCCGC 4 cut(s) 118, 210, 214, 296
FbaI TGATCA 1 cut(s) 759
Fnu4HI GCNGC 5 cut(s) 89, 92, 95, 236, 300
FokI GGATG 5 cut(s) 43, 147, 242, 329, 494
Fsp4HI GCNGC 5 cut(s) 89, 92, 95, 236, 300
FspBI CTAG 2 cut(s) 432, 701
GlaI GCGC 1 cut(s) 605
GluI GCNGC 5 cut(s) 89, 92, 95, 236, 300
GsaI CCCAGC 2 cut(s) 235, 445
GsuI CTGGAG 2 cut(s) 246, 740
HaeIII GGCC 3 cut(s) 214, 249, 271
HapII CCGG 5 cut(s) 15, 152, 246, 268, 305
HhaI GCGC 1 cut(s) 606
Hin1II CATG 2 cut(s) 515, 601
Hin6I GCGC 1 cut(s) 604
HinP1I GCGC 1 cut(s) 604
HindIII AAGCTT 1 cut(s) 142
HinfI GANTC 3 cut(s) 180, 667, 738
HpaII CCGG 5 cut(s) 15, 152, 246, 268, 305
Hpy188I TCNGA 2 cut(s) 117, 414
Hpy188III TCNNGA 4 cut(s) 263, 305, 512, 661
Hpy99I CGWCG 1 cut(s) 124
HpyAV CCTTC 4 cut(s) 47, 122, 199, 461
HpyCH4III ACNGT 3 cut(s) 378, 477, 538
HpyCH4IV ACGT 2 cut(s) 496, 616
HpyCH4V TGCA 1 cut(s) 314
HpyF10VI GCNNNNNNNGC 6 cut(s) 94, 206, 211, 220, 241, 288
HpyF3I CTNAG 2 cut(s) 413, 776
HpySE526I ACGT 2 cut(s) 496, 616
Hsp92II CATG 2 cut(s) 515, 601
HspAI GCGC 1 cut(s) 604
Kpn2I TCCGGA 1 cut(s) 304
Ksp22I TGATCA 1 cut(s) 759
Kzo9I GATC 5 cut(s) 193, 227, 427, 657, 759
LmnI GCTCC 2 cut(s) 307, 528
Lsp1109I GCAGC 4 cut(s) 103, 106, 247, 311
LweI GCATC 1 cut(s) 472
MaeI CTAG 2 cut(s) 432, 701
MaeII ACGT 2 cut(s) 496, 616
MalI GATC 5 cut(s) 195, 229, 429, 659, 761
MboI GATC 5 cut(s) 193, 227, 427, 657, 759
MboII GAAGA 3 cut(s) 472, 659, 676
MflI RGATCY 1 cut(s) 227
MluCI AATT 2 cut(s) 622, 693
MlyI GAGTC 2 cut(s) 189, 661
MnlI CCTC 9 cut(s) 69, 114, 225, 260, 270, 282, 408, 773, 783
MroI TCCGGA 1 cut(s) 304
MroXI GAANNNNTTC 1 cut(s) 450
MseI TTAA 4 cut(s) 404, 489, 540, 579
MspCI CTTAAG 1 cut(s) 488
MspI CCGG 5 cut(s) 15, 152, 246, 268, 305
MspR9I CCNGG 2 cut(s) 153, 246
MwoI GCNNNNNNNGC 6 cut(s) 94, 206, 211, 220, 241, 288
NciI CCSGG 2 cut(s) 153, 246
NdeII GATC 5 cut(s) 193, 227, 427, 657, 759
NlaIII CATG 2 cut(s) 515, 601
NspI RCATGY 1 cut(s) 601
PagI TCATGA 1 cut(s) 511
PciI ACATGT 1 cut(s) 597
PdmI GAANNNNTTC 1 cut(s) 450
PfeI GAWTC 1 cut(s) 738
PkrI GCNGC 5 cut(s) 90, 93, 96, 237, 301
PleI GAGTC 2 cut(s) 188, 661
PpsI GAGTC 2 cut(s) 188, 661
PscI ACATGT 1 cut(s) 597
PspFI CCCAGC 2 cut(s) 231, 441
PspPI GGNCC 1 cut(s) 374
PsuI RGATCY 1 cut(s) 227
SaqAI TTAA 4 cut(s) 404, 489, 540, 579
SatI GCNGC 5 cut(s) 89, 92, 95, 236, 300
Sau3AI GATC 5 cut(s) 193, 227, 427, 657, 759
Sau96I GGNCC 1 cut(s) 374
SchI GAGTC 2 cut(s) 189, 661
ScrFI CCNGG 2 cut(s) 153, 246
SfaNI GCATC 1 cut(s) 472
SinI GGWCC 1 cut(s) 374
SmlI CTYRAG 2 cut(s) 73, 488
SmoI CTYRAG 2 cut(s) 73, 488
Sse9I AATT 2 cut(s) 622, 693
SsiI CCGC 7 cut(s) 88, 125, 203, 207, 289, 556, 766
SspMI CTAG 2 cut(s) 432, 701
StyD4I CCNGG 2 cut(s) 151, 244
StyI CCWWGG 1 cut(s) 45
TaaI ACNGT 3 cut(s) 378, 477, 538
TaiI ACGT 2 cut(s) 499, 619
TaqI TCGA 2 cut(s) 192, 252
TasI AATT 2 cut(s) 622, 693
TauI GCSGC 1 cut(s) 91
TfiI GAWTC 1 cut(s) 738
Tru1I TTAA 4 cut(s) 404, 489, 540, 579
Tru9I TTAA 4 cut(s) 404, 489, 540, 579
TscAI CASTG 2 cut(s) 340, 361
TseI GCWGC 4 cut(s) 91, 94, 235, 299
TspDTI ATGAA 2 cut(s) 500, 564
TspRI CASTG 2 cut(s) 340, 361
Vha464I CTTAAG 1 cut(s) 488
VpaK11BI GGWCC 1 cut(s) 374
XapI RAATTY 1 cut(s) 622
XceI RCATGY 1 cut(s) 601
XmnI GAANNNNTTC 1 cut(s) 450
XspI CTAG 2 cut(s) 432, 701
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.