Rmu_sc0005104.1_g000010

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005104.1
N/A
Physical Location & Seq
Forward (+)
55358 .. 56038
681 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005104.1_g000010.1.cds

Sequence Viewer

Length: 267 bp
atgaaccagtaccacatatacgaggccatcggccgtggaaagtgctcgactgtgtacaaagggaggaagaagaagacgattgagtacttcgccattaagagcgtcgagaaatctcagaagagcaagcttcttcaggaagttaagattcttcataccctagatcatcagaatattctcaagttttattggtggtacgaaacttctgctcacttgtggttagttctggagtattgcgttggcgggaatttgatgacattgttagaccag
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.6

Weight (kDa)

9.25

Isoelectric Point (pI)

30.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 240
AcoI YGGCCR 1 cut(s) 31
AcsI RAATTY 1 cut(s) 244
AcuI CTGAAG 1 cut(s) 116
AfaI GTAC 4 cut(s) 11, 56, 86, 194
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
Alw21I GWGCWC 1 cut(s) 47
AoxI GGCC 2 cut(s) 24, 31
ApoI RAATTY 1 cut(s) 244
BbsI GAAGAC 1 cut(s) 80
Bbv12I GWGCWC 1 cut(s) 47
BccI CCATC 1 cut(s) 35
BceAI ACGGC 1 cut(s) 18
BcgI CGANNNNNNTGC 2 cut(s) 185, 219
BfaI CTAG 1 cut(s) 158
BmcAI AGTACT 1 cut(s) 86
BpiI GAAGAC 1 cut(s) 80
BpmI CTGGAG 1 cut(s) 245
BpuEI CTTGAG 1 cut(s) 161
BsaJI CCNNGG 1 cut(s) 34
Bse1I ACTGG 1 cut(s) 7
BseDI CCNNGG 1 cut(s) 34
BseMII CTCAG 1 cut(s) 128
BseNI ACTGG 1 cut(s) 7
BseX3I CGGCCG 1 cut(s) 31
Bsh1285I CGRYCG 1 cut(s) 34
BshFI GGCC 2 cut(s) 26, 33
BsiEI CGRYCG 1 cut(s) 34
BsiHKAI GWGCWC 1 cut(s) 47
BsnI GGCC 2 cut(s) 26, 33
Bsp1286I GDGCHC 1 cut(s) 47
Bsp1407I TGTACA 1 cut(s) 54
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 1 cut(s) 240
BspANI GGCC 2 cut(s) 26, 33
BspCNI CTCAG 1 cut(s) 127
BspQI GCTCTTC 1 cut(s) 113
BsrGI TGTACA 1 cut(s) 54
BsrI ACTGG 1 cut(s) 7
BssECI CCNNGG 1 cut(s) 34
BssMI GATC 1 cut(s) 160
Bst4CI ACNGT 1 cut(s) 52
Bst6I CTCTTC 1 cut(s) 113
BstAUI TGTACA 1 cut(s) 54
BstC8I GCNNGC 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 114
BstDSI CCRYGG 1 cut(s) 34
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstMCI CGRYCG 1 cut(s) 34
BstV2I GAAGAC 1 cut(s) 80
BstZI CGGCCG 1 cut(s) 31
BsuRI GGCC 2 cut(s) 26, 33
BtgI CCRYGG 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 125
CseI GACGC 1 cut(s) 91
Csp6I GTAC 4 cut(s) 10, 55, 85, 193
CviJI RGCY 3 cut(s) 26, 33, 127
CviKI_1 RGCY 3 cut(s) 26, 33, 127
CviQI GTAC 4 cut(s) 10, 55, 85, 193
DdeI CTNAG 1 cut(s) 114
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
EaeI YGGCCR 1 cut(s) 31
EagI CGGCCG 1 cut(s) 31
Eam1104I CTCTTC 1 cut(s) 113
EarI CTCTTC 1 cut(s) 113
EclXI CGGCCG 1 cut(s) 31
Eco52I CGGCCG 1 cut(s) 31
Eco57I CTGAAG 1 cut(s) 116
FaiI YATR 3 cut(s) 17, 19, 153
FauI CCCGC 1 cut(s) 233
FspBI CTAG 1 cut(s) 158
GsuI CTGGAG 1 cut(s) 245
HaeIII GGCC 2 cut(s) 26, 33
HgaI GACGC 1 cut(s) 91
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 55
Hpy188I TCNGA 2 cut(s) 117, 168
Hpy188III TCNNGA 3 cut(s) 106, 134, 224
Hpy8I GTNNAC 1 cut(s) 55
Hpy99I CGWCG 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 52
HpyF3I CTNAG 1 cut(s) 114
Kzo9I GATC 1 cut(s) 160
LguI GCTCTTC 1 cut(s) 113
LpnPI CCDG 3 cut(s) 20, 119, 209
MaeI CTAG 1 cut(s) 158
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 6 cut(s) 79, 82, 85, 122, 130, 140
MhlI GDGCHC 1 cut(s) 47
MluCI AATT 1 cut(s) 244
MnlI CCTC 2 cut(s) 16, 57
MseI TTAA 2 cut(s) 96, 141
NdeII GATC 1 cut(s) 160
PciSI GCTCTTC 1 cut(s) 113
PfeI GAWTC 1 cut(s) 145
RsaI GTAC 4 cut(s) 11, 56, 86, 194
RsaNI GTAC 4 cut(s) 10, 55, 85, 193
SapI GCTCTTC 1 cut(s) 113
SaqAI TTAA 2 cut(s) 96, 141
Sau3AI GATC 1 cut(s) 160
ScaI AGTACT 1 cut(s) 86
SduI GDGCHC 1 cut(s) 47
SetI ASST 1 cut(s) 129
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
Sse9I AATT 1 cut(s) 244
SsiI CCGC 1 cut(s) 240
SspI AATATT 1 cut(s) 172
SspMI CTAG 1 cut(s) 158
TaaI ACNGT 1 cut(s) 52
TaqI TCGA 2 cut(s) 47, 105
TasI AATT 1 cut(s) 244
TatI WGTACW 2 cut(s) 54, 84
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 2 cut(s) 96, 141
Tru9I TTAA 2 cut(s) 96, 141
TspDTI ATGAA 2 cut(s) 17, 140
XapI RAATTY 1 cut(s) 244
XspI CTAG 1 cut(s) 158
ZrmI AGTACT 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.