Rmu_sc0005127.1_g000012

Neddylation of cullins play an essential role in the regulation of SCF-type complexes activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005127.1
N/A
Physical Location & Seq
Forward (+)
73766 .. 74820
1055 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 330 bp
atggccacacccaaatttgaagatttctatgcttttgcatttcaatactgcttgacagaagacaggcaaaagagtgttgatatcgaaactgtttgtgaattactgagtcttgtgcttggtcccaaataccgttcccaggttgatgtattaataaagtatctgaaggtccaaagtgagtacagggcattaaatgcggatcagtggagacatttttaccgtttttgcaaggagataagtttcccagatctcgaagactatgattctgatcaagcatggcctgtgataattgataatcttgttgaatggatgaaagagaacaagcaaagctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cullin_binding

Protein Analysis

109

Amino Acids

13.09

Weight (kDa)

4.71

Isoelectric Point (pI)

50.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cullin_binding PF03556 5 - 102 1.9e-25 Cullin binding
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 194
AclWI GGATC 1 cut(s) 204
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 14
AcuI CTGAAG 1 cut(s) 182
AfaI GTAC 1 cut(s) 179
AfiI CCNNNNNNNGG 1 cut(s) 136
AgsI TTSAA 3 cut(s) 20, 44, 302
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 1 cut(s) 327
AluI AGCT 1 cut(s) 327
Alw26I GTCTC 1 cut(s) 199
AlwI GGATC 1 cut(s) 204
AoxI GGCC 2 cut(s) 3, 275
ApoI RAATTY 1 cut(s) 14
AseI ATTAAT 1 cut(s) 149
AspS9I GGNCC 2 cut(s) 119, 166
AvaII GGWCC 2 cut(s) 119, 166
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 2 cut(s) 66, 258
BciT130I CCWGG 1 cut(s) 137
BclI TGATCA 1 cut(s) 265
BcoDI GTCTC 1 cut(s) 199
BfaI CTAG 1 cut(s) 328
BglII AGATCT 1 cut(s) 244
Bme1390I CCNGG 1 cut(s) 137
Bme18I GGWCC 2 cut(s) 119, 166
BmgT120I GGNCC 2 cut(s) 119, 166
BmiI GGNNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 137
BpiI GAAGAC 2 cut(s) 66, 258
BsaBI GATNNNNATC 1 cut(s) 264
BsaJI CCNNGG 1 cut(s) 135
Bsc4I CCNNNNNNNGG 1 cut(s) 136
Bse8I GATNNNNATC 1 cut(s) 264
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 135
BseGI GGATG 1 cut(s) 312
BseJI GATNNNNATC 1 cut(s) 264
BseLI CCNNNNNNNGG 1 cut(s) 136
BseMII CTCAG 1 cut(s) 95
BshFI GGCC 2 cut(s) 5, 277
BslFI GGGAC 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 136
BsmAI GTCTC 1 cut(s) 199
BsmFI GGGAC 1 cut(s) 105
BsnI GGCC 2 cut(s) 5, 277
Bsp143I GATC 3 cut(s) 196, 244, 265
BspACI CCGC 1 cut(s) 194
BspANI GGCC 2 cut(s) 5, 277
BspCNI CTCAG 1 cut(s) 96
BspLI GGNNCC 1 cut(s) 121
BspPI GGATC 1 cut(s) 204
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 3 cut(s) 196, 244, 265
Bst2UI CCWGG 1 cut(s) 137
Bst4CI ACNGT 3 cut(s) 91, 131, 218
BstAPI GCANNNNNTGC 1 cut(s) 191
BstDEI CTNAG 1 cut(s) 104
BstF5I GGATG 1 cut(s) 312
BstKTI GATC 3 cut(s) 199, 247, 268
BstMAI GTCTC 1 cut(s) 199
BstMBI GATC 3 cut(s) 196, 244, 265
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
BstV2I GAAGAC 2 cut(s) 66, 258
BstX2I RGATCY 1 cut(s) 244
BstYI RGATCY 1 cut(s) 244
BsuRI GGCC 2 cut(s) 5, 277
BtsCI GGATG 1 cut(s) 312
BtsIMutI CAGTG 1 cut(s) 206
Cfr13I GGNCC 2 cut(s) 119, 166
Csp6I GTAC 1 cut(s) 178
CviAII CATG 1 cut(s) 273
CviJI RGCY 3 cut(s) 5, 277, 327
CviKI_1 RGCY 3 cut(s) 5, 277, 327
CviQI GTAC 1 cut(s) 178
DdeI CTNAG 1 cut(s) 104
DpnI GATC 3 cut(s) 198, 246, 267
DpnII GATC 3 cut(s) 196, 244, 265
EaeI YGGCCR 1 cut(s) 3
Eco32I GATATC 1 cut(s) 82
Eco47I GGWCC 2 cut(s) 119, 166
Eco57I CTGAAG 1 cut(s) 182
EcoRII CCWGG 1 cut(s) 135
EcoRV GATATC 1 cut(s) 82
FaeI CATG 1 cut(s) 276
FaiI YATR 3 cut(s) 30, 258, 274
FaqI GGGAC 1 cut(s) 105
FatI CATG 1 cut(s) 272
FbaI TGATCA 1 cut(s) 265
FokI GGATG 1 cut(s) 319
FspBI CTAG 1 cut(s) 328
HaeIII GGCC 2 cut(s) 5, 277
Hin1II CATG 1 cut(s) 276
HinfI GANTC 2 cut(s) 106, 260
Hpy188I TCNGA 2 cut(s) 162, 265
Hpy188III TCNNGA 1 cut(s) 248
HpyAV CCTTC 1 cut(s) 157
HpyCH4III ACNGT 3 cut(s) 91, 131, 218
HpyCH4V TGCA 2 cut(s) 38, 225
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 1 cut(s) 276
Ksp22I TGATCA 1 cut(s) 265
Kzo9I GATC 3 cut(s) 196, 244, 265
LpnPI CCDG 6 cut(s) 49, 122, 149, 166, 255, 291
MaeI CTAG 1 cut(s) 328
MalI GATC 3 cut(s) 198, 246, 267
MboI GATC 3 cut(s) 196, 244, 265
MboII GAAGA 3 cut(s) 32, 71, 263
MflI RGATCY 1 cut(s) 244
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 14, 98, 285
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 115
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 149, 188
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 191
NdeII GATC 3 cut(s) 196, 244, 265
NlaIII CATG 1 cut(s) 276
NlaIV GGNNCC 1 cut(s) 121
PfeI GAWTC 1 cut(s) 260
PleI GAGTC 1 cut(s) 114
PpsI GAGTC 1 cut(s) 114
PshBI ATTAAT 1 cut(s) 149
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 121
PspPI GGNCC 2 cut(s) 119, 166
PsuI RGATCY 1 cut(s) 244
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
SaqAI TTAA 2 cut(s) 149, 188
Sau3AI GATC 3 cut(s) 196, 244, 265
Sau96I GGNCC 2 cut(s) 119, 166
SchI GAGTC 1 cut(s) 115
ScrFI CCNGG 1 cut(s) 137
SetI ASST 3 cut(s) 141, 168, 329
SinI GGWCC 2 cut(s) 119, 166
Sse9I AATT 3 cut(s) 14, 98, 285
SsiI CCGC 1 cut(s) 194
SspMI CTAG 1 cut(s) 328
StyD4I CCNGG 1 cut(s) 135
TaaI ACNGT 3 cut(s) 91, 131, 218
TaqI TCGA 2 cut(s) 84, 249
TasI AATT 3 cut(s) 14, 98, 285
TatI WGTACW 1 cut(s) 177
TfiI GAWTC 1 cut(s) 260
Tru1I TTAA 2 cut(s) 149, 188
Tru9I TTAA 2 cut(s) 149, 188
TscAI CASTG 1 cut(s) 206
TspDTI ATGAA 1 cut(s) 323
TspRI CASTG 1 cut(s) 206
VpaK11BI GGWCC 2 cut(s) 119, 166
VspI ATTAAT 1 cut(s) 149
XapI RAATTY 1 cut(s) 14
XspI CTAG 1 cut(s) 328
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.