Rmu_sc0005167.1_g000041

Receptor-like protein 12

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005167.1
N/A
Physical Location & Seq
Reverse (-)
207991 .. 208263
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005167.1_g000041.1.cds

Sequence Viewer

Length: 273 bp
atgggattgacatcccgccggtgcttgtctaatgtccccaatattggtctgctttcaagaattttagttctattgttgtttcatgttcttggggctagctccttatactctaggcagcagcagccatctagttgccatgatgaggacagcgctgccttgctgcaatttaagcaaagctttattatcgatccatctgtttcttatgatgatggttcatgtccaaaggtctcatcatggaaggcagctgaaggagatttgatgcgggaagtgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0008150 GO:0009888 GO:0010073 GO:0032501 GO:0032502 GO:0048507 GO:0048856
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

90

Amino Acids

9.89

Weight (kDa)

6.02

Isoelectric Point (pI)

79.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 16, 262
AclWI GGATC 1 cut(s) 182
AcsI RAATTY 1 cut(s) 60
AcuI CTGAAG 1 cut(s) 267
AfeI AGCGCT 1 cut(s) 151
AfiI CCNNNNNNNGG 2 cut(s) 44, 142
AgsI TTSAA 1 cut(s) 57
AluBI AGCT 3 cut(s) 99, 177, 245
AluI AGCT 3 cut(s) 99, 177, 245
Alw26I GTCTC 1 cut(s) 232
AlwI GGATC 1 cut(s) 182
Aor51HI AGCGCT 1 cut(s) 151
ApeKI GCWGC 6 cut(s) 115, 118, 121, 152, 160, 242
ApoI RAATTY 1 cut(s) 60
AspLEI GCGC 1 cut(s) 152
AsuNHI GCTAGC 1 cut(s) 95
BbvI GCAGC 6 cut(s) 127, 130, 133, 139, 147, 254
BccI CCATC 3 cut(s) 133, 199, 203
BcoDI GTCTC 1 cut(s) 232
BfaI CTAG 3 cut(s) 96, 111, 129
BfoI RGCGCY 1 cut(s) 153
BisI GCNGC 6 cut(s) 116, 119, 122, 153, 161, 243
BlsI GCNGC 6 cut(s) 117, 120, 123, 154, 162, 244
BmsI GCATC 1 cut(s) 249
BmtI GCTAGC 1 cut(s) 99
Bsa29I ATCGAT 1 cut(s) 186
BsaBI GATNNNNATC 1 cut(s) 10
BsaI GGTCTC 1 cut(s) 232
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 142
Bse118I RCCGGY 1 cut(s) 18
Bse8I GATNNNNATC 1 cut(s) 10
BseCI ATCGAT 1 cut(s) 186
BseGI GGATG 1 cut(s) 11
BseJI GATNNNNATC 1 cut(s) 10
BseLI CCNNNNNNNGG 2 cut(s) 44, 142
BseXI GCAGC 6 cut(s) 127, 130, 133, 139, 147, 254
BshVI ATCGAT 1 cut(s) 186
BsiSI CCGG 1 cut(s) 19
BslFI GGGAC 1 cut(s) 20
BslI CCNNNNNNNGG 2 cut(s) 44, 142
BsmAI GTCTC 1 cut(s) 232
BsmFI GGGAC 1 cut(s) 20
Bso31I GGTCTC 1 cut(s) 232
Bsp143I GATC 1 cut(s) 187
BspACI CCGC 2 cut(s) 16, 262
BspDI ATCGAT 1 cut(s) 186
BspOI GCTAGC 1 cut(s) 99
BspPI GGATC 1 cut(s) 182
BspTNI GGTCTC 1 cut(s) 232
BsrFI RCCGGY 1 cut(s) 18
BssAI RCCGGY 1 cut(s) 18
BssMI GATC 1 cut(s) 187
BstC8I GCNNGC 1 cut(s) 97
BstF5I GGATG 1 cut(s) 11
BstH2I RGCGCY 1 cut(s) 153
BstHHI GCGC 1 cut(s) 152
BstKTI GATC 1 cut(s) 190
BstMAI GTCTC 1 cut(s) 232
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 2 cut(s) 121, 169
BstV1I GCAGC 6 cut(s) 127, 130, 133, 139, 147, 254
Bsu15I ATCGAT 1 cut(s) 186
BsuTUI ATCGAT 1 cut(s) 186
BtsCI GGATG 1 cut(s) 11
Cac8I GCNNGC 1 cut(s) 97
CfoI GCGC 1 cut(s) 152
Cfr10I RCCGGY 1 cut(s) 18
ClaI ATCGAT 1 cut(s) 186
CviAII CATG 4 cut(s) 83, 137, 216, 234
CviJI RGCY 5 cut(s) 95, 99, 124, 177, 245
CviKI_1 RGCY 5 cut(s) 95, 99, 124, 177, 245
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eco31I GGTCTC 1 cut(s) 232
Eco47III AGCGCT 1 cut(s) 151
Eco57I CTGAAG 1 cut(s) 267
FaeI CATG 4 cut(s) 86, 140, 219, 237
FaiI YATR 6 cut(s) 84, 106, 138, 204, 217, 235
FalI AAGNNNNNCTT 2 cut(s) 161, 193
FaqI GGGAC 1 cut(s) 20
FatI CATG 4 cut(s) 82, 136, 215, 233
FauI CCCGC 2 cut(s) 23, 255
Fnu4HI GCNGC 6 cut(s) 116, 119, 122, 153, 161, 243
Fsp4HI GCNGC 6 cut(s) 116, 119, 122, 153, 161, 243
FspBI CTAG 3 cut(s) 96, 111, 129
GlaI GCGC 1 cut(s) 151
GluI GCNGC 6 cut(s) 116, 119, 122, 153, 161, 243
HaeII RGCGCY 1 cut(s) 153
HapII CCGG 1 cut(s) 19
HhaI GCGC 1 cut(s) 152
Hin1II CATG 4 cut(s) 86, 140, 219, 237
Hin6I GCGC 1 cut(s) 150
HinP1I GCGC 1 cut(s) 150
HindIII AAGCTT 1 cut(s) 175
HpaII CCGG 1 cut(s) 19
Hpy188III TCNNGA 1 cut(s) 57
HpyAV CCTTC 2 cut(s) 232, 242
HpyCH4V TGCA 1 cut(s) 163
HpyF10VI GCNNNNNNNGC 2 cut(s) 121, 169
Hsp92II CATG 4 cut(s) 86, 140, 219, 237
HspAI GCGC 1 cut(s) 150
Kzo9I GATC 1 cut(s) 187
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 1 cut(s) 32
Lsp1109I GCAGC 6 cut(s) 127, 130, 133, 139, 147, 254
LweI GCATC 1 cut(s) 249
MaeI CTAG 3 cut(s) 96, 111, 129
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MluCI AATT 2 cut(s) 60, 164
MnlI CCTC 1 cut(s) 136
MseI TTAA 1 cut(s) 168
MspA1I CMGCKG 1 cut(s) 245
MspI CCGG 1 cut(s) 19
MwoI GCNNNNNNNGC 2 cut(s) 121, 169
NdeII GATC 1 cut(s) 187
NheI GCTAGC 1 cut(s) 95
NlaIII CATG 4 cut(s) 86, 140, 219, 237
PkrI GCNGC 6 cut(s) 117, 120, 123, 154, 162, 244
PvuII CAGCTG 1 cut(s) 245
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 6 cut(s) 116, 119, 122, 153, 161, 243
Sau3AI GATC 1 cut(s) 187
SetI ASST 4 cut(s) 101, 179, 228, 247
SfaNI GCATC 1 cut(s) 249
SgrAI CRCCGGYG 1 cut(s) 18
Sse9I AATT 2 cut(s) 60, 164
SsiI CCGC 2 cut(s) 16, 262
SspI AATATT 1 cut(s) 43
SspMI CTAG 3 cut(s) 96, 111, 129
TaqI TCGA 1 cut(s) 186
TasI AATT 2 cut(s) 60, 164
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TseI GCWGC 6 cut(s) 115, 118, 121, 152, 160, 242
TspDTI ATGAA 2 cut(s) 71, 204
XapI RAATTY 1 cut(s) 60
XspI CTAG 3 cut(s) 96, 111, 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.