Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005356.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

27366 .. 29816

Gene Structure 2451 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 738 bp

atgagagtggcagtgattggttctggtatcagtggtttggtctcagcctatgttcttgcaaaagatggggttgaagtggatctgtatgagaaagaagactacttgggtggtcatgccaggacggtcacatttgatggcgtcgatttggaccttgcatgcggtttcaggcggcgacggcaacacagggctggtaggagggaggccgaaggcctccaagacctcttctgggcagcgatcgaggttggaggaggtcggggttgccggtttctgggcagccacctcacctgcaactgcaggttctgtgtagcgctgcagaacggtcgcaagcgactccacccaacagtagatcggcttcgtagacccccgcgtccattcggcaagccgcacagtgctgtcgactctcgatcgaggccgaaggagcgacgtccgcactttttctgggttgcggatgtcctctctcgaacggctccgttctgtgcagcgctgcagaacggtcgcaggcgactccacccaacagtagatcggcttcgtagaccccagcatccattcggcaagccacacagtgctgtcgacgctcgatcgaggccgaaggagcgacgtccgcactttttctgggttgcggatgtccgctctcgaacggctccattgggatttaaacttcaattagcgtcggcggaattcaaacctgagtgtgggggtttcatacctggaagctcttatcaattcaaccacctgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006629 GO:0008150 GO:0008152 GO:0008168 GO:0008757 GO:0008825 GO:0009987 GO:0016740 GO:0016741 GO:0030258 GO:0032259 GO:0044237 GO:0044238 GO:0044255 GO:0044424 GO:0044444 GO:0044464 GO:0071704

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Amino_oxidase CMAS NAD_binding_8

Protein Analysis

245

Amino Acids

27.7

Weight (kDa)

10.78

Isoelectric Point (pI)

59.85

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DAO	PF01266	2 - 39	5.1e-07	FAD dependent oxidoreductase
NAD_binding_8	PF13450	5 - 51	9e-14	NAD(P)-binding Rossmann-like domain
Amino_oxidase	PF01593	10 - 51	5e-07	Flavin containing amine oxidoreductase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	293
AasI	GACNNNNNNGTC	1 cut(s)	366
AatII	GACGTC	2 cut(s)	427, 601
Acc36I	ACCTGC	2 cut(s)	285, 293
AccBSI	CCGCTC	1 cut(s)	630
AccI	GTMKAC	4 cut(s)	358, 396, 532, 570
AccII	CGCG	1 cut(s)	367
AclWI	GGATC	1 cut(s)	87
AcsI	RAATTY	1 cut(s)	677
AcyI	GRCGYC	3 cut(s)	138, 424, 598
AdeI	CACNNNGTG	1 cut(s)	563
AfeI	AGCGCT	2 cut(s)	309, 483
AfiI	CCNNNNNNNGG	3 cut(s)	226, 268, 692
AgsI	TTSAA	4 cut(s)	74, 662, 682, 727
AjnI	CCWGG	2 cut(s)	116, 706
AluBI	AGCT	1 cut(s)	714
AluI	AGCT	1 cut(s)	714
Alw26I	GTCTC	1 cut(s)	46
AlwI	GGATC	1 cut(s)	87
AlwNI	CAGNNNCTG	1 cut(s)	300
Aor51HI	AGCGCT	2 cut(s)	309, 483
AoxI	GGCC	4 cut(s)	201, 208, 410, 584
ApeKI	GCWGC	5 cut(s)	230, 273, 310, 479, 484
ApoI	RAATTY	1 cut(s)	677
AspLEI	GCGC	2 cut(s)	310, 484
AspS9I	GGNCC	1 cut(s)	148
AsuHPI	GGTGA	1 cut(s)	274
AvaII	GGWCC	1 cut(s)	148
BarI	GAAGNNNNNNTAC	4 cut(s)	336, 368, 510, 542
BbsI	GAAGAC	1 cut(s)	102
BbvI	GCAGC	5 cut(s)	242, 285, 297, 471, 491
BccI	CCATC	2 cut(s)	59, 128
BceAI	ACGGC	3 cut(s)	191, 480, 654
BcgI	CGANNNNNNTGC	4 cut(s)	302, 336, 476, 510
BciT130I	CCWGG	2 cut(s)	118, 708
BcoDI	GTCTC	1 cut(s)	46
BfmI	CTRYAG	4 cut(s)	292, 311, 485, 734
BfoI	RGCGCY	2 cut(s)	311, 485
BfuAI	ACCTGC	2 cut(s)	285, 293
BisI	GCNGC	7 cut(s)	170, 231, 274, 311, 383, 480, 485
BlsI	GCNGC	7 cut(s)	171, 232, 275, 312, 384, 481, 486
Bme1390I	CCNGG	2 cut(s)	118, 708
Bme18I	GGWCC	1 cut(s)	148
BmgT120I	GGNCC	1 cut(s)	148
BmiI	GGNNCC	2 cut(s)	468, 642
BmrFI	CCNGG	2 cut(s)	118, 708
BmsI	GCATC	1 cut(s)	550
BpiI	GAAGAC	1 cut(s)	102
BsaHI	GRCGYC	3 cut(s)	138, 424, 598
BsaI	GGTCTC	1 cut(s)	46
Bsc4I	CCNNNNNNNGG	3 cut(s)	226, 268, 692
Bse118I	RCCGGY	1 cut(s)	261
BseBI	CCWGG	2 cut(s)	118, 708
BseGI	GGATG	3 cut(s)	454, 541, 628
BseLI	CCNNNNNNNGG	3 cut(s)	226, 268, 692
BseMII	CTCAG	2 cut(s)	57, 678
BseRI	GAGGAG	1 cut(s)	261
BseXI	GCAGC	5 cut(s)	242, 285, 297, 471, 491
BseYI	CCCAGC	1 cut(s)	537
BsgI	GTGCAG	1 cut(s)	498
Bsh1236I	CGCG	1 cut(s)	367
Bsh1285I	CGRYCG	5 cut(s)	237, 322, 407, 496, 581
BshFI	GGCC	4 cut(s)	203, 210, 412, 586
BsiEI	CGRYCG	5 cut(s)	237, 322, 407, 496, 581
BsiSI	CCGG	1 cut(s)	262
BslI	CCNNNNNNNGG	3 cut(s)	226, 268, 692
BsmAI	GTCTC	1 cut(s)	46
BsnI	GGCC	4 cut(s)	203, 210, 412, 586
Bso31I	GGTCTC	1 cut(s)	46
Bsp143I	GATC	6 cut(s)	79, 234, 346, 404, 520, 578
BspANI	GGCC	4 cut(s)	203, 210, 412, 586
BspCNI	CTCAG	2 cut(s)	56, 679
BspFNI	CGCG	1 cut(s)	367
BspLI	GGNNCC	2 cut(s)	468, 642
BspMAI	CTGCAG	3 cut(s)	296, 315, 489
BspMI	ACCTGC	2 cut(s)	285, 293
BspPI	GGATC	1 cut(s)	87
BspTNI	GGTCTC	1 cut(s)	46
BsrBI	CCGCTC	1 cut(s)	630
BsrFI	RCCGGY	1 cut(s)	261
BssAI	RCCGGY	1 cut(s)	261
BssMI	GATC	6 cut(s)	79, 234, 346, 404, 520, 578
BssNI	GRCGYC	3 cut(s)	138, 424, 598
Bst2UI	CCWGG	2 cut(s)	118, 708
Bst4CI	ACNGT	7 cut(s)	124, 320, 343, 389, 494, 517, 563
Bst6I	CTCTTC	1 cut(s)	227
BstACI	GRCGYC	3 cut(s)	138, 424, 598
BstC8I	GCNNGC	5 cut(s)	157, 326, 380, 500, 554
BstDEI	CTNAG	2 cut(s)	43, 687
BstF5I	GGATG	3 cut(s)	454, 541, 628
BstFNI	CGCG	1 cut(s)	367
BstH2I	RGCGCY	2 cut(s)	311, 485
BstHHI	GCGC	2 cut(s)	310, 484
BstKTI	GATC	6 cut(s)	82, 237, 349, 407, 523, 581
BstMAI	GTCTC	1 cut(s)	46
BstMBI	GATC	6 cut(s)	79, 234, 346, 404, 520, 578
BstMCI	CGRYCG	5 cut(s)	237, 322, 407, 496, 581
BstMWI	GCNNNNNNNGC	6 cut(s)	175, 418, 427, 572, 592, 601
BstNI	CCWGG	2 cut(s)	118, 708
BstNSI	RCATGY	1 cut(s)	159
BstSCI	CCNGG	2 cut(s)	116, 706
BstSFI	CTRYAG	4 cut(s)	292, 311, 485, 734
BstUI	CGCG	1 cut(s)	367
BstV1I	GCAGC	5 cut(s)	242, 285, 297, 471, 491
BstV2I	GAAGAC	1 cut(s)	102
BstX2I	RGATCY	1 cut(s)	79
BstYI	RGATCY	1 cut(s)	79
BsuRI	GGCC	4 cut(s)	203, 210, 412, 586
BtsCI	GGATG	3 cut(s)	454, 541, 628
BtsI	GCAGTG	1 cut(s)	18
BtsIMutI	CAGTG	4 cut(s)	18, 37, 394, 568
BveI	ACCTGC	2 cut(s)	285, 293
Cac8I	GCNNGC	5 cut(s)	157, 326, 380, 500, 554
CaiI	CAGNNNCTG	1 cut(s)	300
CfoI	GCGC	2 cut(s)	310, 484
Cfr10I	RCCGGY	1 cut(s)	261
Cfr13I	GGNCC	1 cut(s)	148
CseI	GACGC	4 cut(s)	127, 356, 581, 657
CviAII	CATG	2 cut(s)	113, 156
DdeI	CTNAG	2 cut(s)	43, 687
DpnI	GATC	6 cut(s)	81, 236, 348, 406, 522, 580
DpnII	GATC	6 cut(s)	79, 234, 346, 404, 520, 578
DraI	TTTAAA	1 cut(s)	655
DraIII	CACNNNGTG	1 cut(s)	563
DrdI	GACNNNNNNGTC	1 cut(s)	366
DseDI	GACNNNNNNGTC	1 cut(s)	366
Eam1104I	CTCTTC	1 cut(s)	227
EarI	CTCTTC	1 cut(s)	227
EciI	GGCGGA	1 cut(s)	689
Eco147I	AGGCCT	1 cut(s)	210
Eco31I	GGTCTC	1 cut(s)	46
Eco47I	GGWCC	1 cut(s)	148
Eco47III	AGCGCT	2 cut(s)	309, 483
EcoRI	GAATTC	1 cut(s)	677
EcoRII	CCWGG	2 cut(s)	116, 706
FaeI	CATG	2 cut(s)	116, 159
FaiI	YATR	5 cut(s)	51, 87, 114, 157, 704
FatI	CATG	2 cut(s)	112, 155
FauI	CCCGC	1 cut(s)	372
FblI	GTMKAC	4 cut(s)	358, 396, 532, 570
Fnu4HI	GCNGC	7 cut(s)	170, 231, 274, 311, 383, 480, 485
FokI	GGATG	3 cut(s)	461, 528, 635
Fsp4HI	GCNGC	7 cut(s)	170, 231, 274, 311, 383, 480, 485
GlaI	GCGC	2 cut(s)	309, 483
GluI	GCNGC	7 cut(s)	170, 231, 274, 311, 383, 480, 485
GsaI	CCCAGC	1 cut(s)	541
HaeII	RGCGCY	2 cut(s)	311, 485
HaeIII	GGCC	4 cut(s)	203, 210, 412, 586
HapII	CCGG	1 cut(s)	262
HgaI	GACGC	4 cut(s)	127, 356, 581, 657
HhaI	GCGC	2 cut(s)	310, 484
Hin1I	GRCGYC	3 cut(s)	138, 424, 598
Hin1II	CATG	2 cut(s)	116, 159
Hin6I	GCGC	2 cut(s)	308, 482
HinP1I	GCGC	2 cut(s)	308, 482
HincII	GTYRAC	2 cut(s)	397, 571
HindII	GTYRAC	2 cut(s)	397, 571
HinfI	GANTC	3 cut(s)	330, 398, 504
HpaII	CCGG	1 cut(s)	262
HphI	GGTGA	1 cut(s)	274
Hpy166II	GTNNAC	4 cut(s)	359, 397, 533, 571
Hpy188III	TCNNGA	3 cut(s)	402, 459, 633
Hpy8I	GTNNAC	4 cut(s)	359, 397, 533, 571
Hpy99I	CGWCG	6 cut(s)	143, 177, 426, 575, 600, 673
HpyAV	CCTTC	3 cut(s)	200, 409, 583
HpyCH4III	ACNGT	7 cut(s)	124, 320, 343, 389, 494, 517, 563
HpyCH4IV	ACGT	2 cut(s)	424, 598
HpyCH4V	TGCA	7 cut(s)	59, 155, 288, 294, 313, 479, 487
HpyF10VI	GCNNNNNNNGC	6 cut(s)	175, 418, 427, 572, 592, 601
HpyF3I	CTNAG	2 cut(s)	43, 687
HpySE526I	ACGT	2 cut(s)	424, 598
Hsp92I	GRCGYC	3 cut(s)	138, 424, 598
Hsp92II	CATG	2 cut(s)	116, 159
HspAI	GCGC	2 cut(s)	308, 482
Kzo9I	GATC	6 cut(s)	79, 234, 346, 404, 520, 578
LmnI	GCTCC	4 cut(s)	418, 472, 592, 646
Lsp1109I	GCAGC	5 cut(s)	242, 285, 297, 471, 491
LweI	GCATC	1 cut(s)	550
MaeII	ACGT	2 cut(s)	424, 598
MaeIII	GTNAC	1 cut(s)	124
MalI	GATC	6 cut(s)	81, 236, 348, 406, 522, 580
MbiI	CCGCTC	1 cut(s)	630
MboI	GATC	6 cut(s)	79, 234, 346, 404, 520, 578
MboII	GAAGA	2 cut(s)	107, 214
MflI	RGATCY	1 cut(s)	79
MluCI	AATT	3 cut(s)	662, 677, 722
MlyI	GAGTC	3 cut(s)	324, 392, 498
MmeI	TCCRAC	1 cut(s)	223
MseI	TTAA	1 cut(s)	654
MspI	CCGG	1 cut(s)	262
MspR9I	CCNGG	2 cut(s)	118, 708
MvaI	CCWGG	2 cut(s)	118, 708
MvnI	CGCG	1 cut(s)	367
MwoI	GCNNNNNNNGC	6 cut(s)	175, 418, 427, 572, 592, 601
NdeII	GATC	6 cut(s)	79, 234, 346, 404, 520, 578
NlaIII	CATG	2 cut(s)	116, 159
NlaIV	GGNNCC	2 cut(s)	468, 642
NmuCI	GTSAC	1 cut(s)	124
NspI	RCATGY	1 cut(s)	159
PaeI	GCATGC	1 cut(s)	159
PaqCI	CACCTGC	1 cut(s)	293
PceI	AGGCCT	1 cut(s)	210
PkrI	GCNGC	7 cut(s)	171, 232, 275, 312, 384, 481, 486
Ple19I	CGATCG	3 cut(s)	237, 407, 581
PleI	GAGTC	3 cut(s)	324, 392, 498
PpsI	GAGTC	3 cut(s)	324, 392, 498
Psp6I	CCWGG	2 cut(s)	116, 706
PspFI	CCCAGC	1 cut(s)	537
PspGI	CCWGG	2 cut(s)	116, 706
PspN4I	GGNNCC	2 cut(s)	468, 642
PspPI	GGNCC	1 cut(s)	148
PstI	CTGCAG	3 cut(s)	296, 315, 489
PstNI	CAGNNNCTG	1 cut(s)	300
PsuI	RGATCY	1 cut(s)	79
PvuI	CGATCG	3 cut(s)	237, 407, 581
SalI	GTCGAC	2 cut(s)	395, 569
SaqAI	TTAA	1 cut(s)	654
SatI	GCNGC	7 cut(s)	170, 231, 274, 311, 383, 480, 485
Sau3AI	GATC	6 cut(s)	79, 234, 346, 404, 520, 578
Sau96I	GGNCC	1 cut(s)	148
SchI	GAGTC	3 cut(s)	324, 392, 498
ScrFI	CCNGG	2 cut(s)	118, 708
SfaNI	GCATC	1 cut(s)	550
SfcI	CTRYAG	4 cut(s)	292, 311, 485, 734
SinI	GGWCC	1 cut(s)	148
SphI	GCATGC	1 cut(s)	159
Sse9I	AATT	3 cut(s)	662, 677, 722
SseBI	AGGCCT	1 cut(s)	210
StuI	AGGCCT	1 cut(s)	210
StyD4I	CCNGG	2 cut(s)	116, 706
TaaI	ACNGT	7 cut(s)	124, 320, 343, 389, 494, 517, 563
TaiI	ACGT	2 cut(s)	427, 601
TasI	AATT	3 cut(s)	662, 677, 722
TauI	GCSGC	2 cut(s)	172, 385
Tru1I	TTAA	1 cut(s)	654
Tru9I	TTAA	1 cut(s)	654
TscAI	CASTG	4 cut(s)	18, 37, 394, 568
TseFI	GTSAC	1 cut(s)	124
TseI	GCWGC	5 cut(s)	230, 273, 310, 479, 484
Tsp45I	GTSAC	1 cut(s)	124
TspDTI	ATGAA	1 cut(s)	691
TspGWI	ACGGA	1 cut(s)	459
TspRI	CASTG	4 cut(s)	18, 37, 394, 568
VpaK11BI	GGWCC	1 cut(s)	148
XapI	RAATTY	1 cut(s)	677
XceI	RCATGY	1 cut(s)	159
XmiI	GTMKAC	4 cut(s)	358, 396, 532, 570
ZraI	GACGTC	2 cut(s)	425, 599

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.