Rmu_sc0005369.1_g000004

RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation. This subunit can bind 18S rRNA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005369.1
N/A
Physical Location & Seq
Forward (+)
12288 .. 12739
452 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 357 bp
atggaggaggcaatactactctcaaggtttgtaggacttgtggtaagaaagactggtacatacgttcctccgggtttgagagaaggagtgaagagggctctaaggaatgatgagaattcagttcgggtgagcaacctttcggaggatactcgggaccccgatttgcacgaacttttcagtccttttggtgccataagccatgctcatattgttcttgagagagacacccaagttagcagaggatttggttttgttaactttctcagcaaggaacacggccaaaaagccatagacaaactcaatgggtatggttatgacaatctcatcctccgggtagaatgggccacgcctaattga

Protein Analysis

118

Amino Acids

13.29

Weight (kDa)

6.41

Isoelectric Point (pI)

25.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RRM_1 PF00076 41 - 107 7.9e-18 RNA recognition motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 188
AcoI YGGCCR 1 cut(s) 277
AcsI RAATTY 1 cut(s) 115
AfaI GTAC 1 cut(s) 58
AfiI CCNNNNNNNGG 1 cut(s) 142
Alw26I GTCTC 1 cut(s) 216
Ama87I CYCGRG 1 cut(s) 150
AoxI GGCC 2 cut(s) 277, 342
ApoI RAATTY 1 cut(s) 115
AspS9I GGNCC 2 cut(s) 154, 342
AsuC2I CCSGG 2 cut(s) 72, 332
AsuHPI GGTGA 1 cut(s) 139
AvaI CYCGRG 1 cut(s) 150
AvaII GGWCC 1 cut(s) 154
BaeI ACNNNNGTAYC 2 cut(s) 48, 81
BanI GGYRCC 1 cut(s) 188
BanII GRGCYC 1 cut(s) 100
BceAI ACGGC 1 cut(s) 292
BciVI GTATCC 1 cut(s) 139
BcnI CCSGG 2 cut(s) 72, 332
BcoDI GTCTC 1 cut(s) 216
BfuI GTATCC 1 cut(s) 139
Bme1390I CCNGG 2 cut(s) 72, 332
Bme18I GGWCC 1 cut(s) 154
BmeT110I CYCGRG 1 cut(s) 150
BmgT120I GGNCC 2 cut(s) 154, 342
BmiI GGNNCC 3 cut(s) 155, 156, 190
BmrFI CCNGG 2 cut(s) 72, 332
BpuEI CTTGAG 2 cut(s) 7, 236
BpuMI CCSGG 2 cut(s) 72, 332
Bsc4I CCNNNNNNNGG 1 cut(s) 142
Bse1I ACTGG 1 cut(s) 58
BseGI GGATG 1 cut(s) 324
BseLI CCNNNNNNNGG 1 cut(s) 142
BseMII CTCAG 1 cut(s) 277
BseNI ACTGG 1 cut(s) 58
BseRI GAGGAG 1 cut(s) 20
BshFI GGCC 2 cut(s) 279, 344
BshNI GGYRCC 1 cut(s) 188
BsiHKCI CYCGRG 1 cut(s) 150
BsiSI CCGG 2 cut(s) 71, 331
BslFI GGGAC 1 cut(s) 167
BslI CCNNNNNNNGG 1 cut(s) 142
BsmAI GTCTC 1 cut(s) 216
BsmFI GGGAC 1 cut(s) 167
BsnI GGCC 2 cut(s) 279, 344
BsoBI CYCGRG 1 cut(s) 150
Bsp1286I GDGCHC 1 cut(s) 100
BspANI GGCC 2 cut(s) 279, 344
BspCNI CTCAG 1 cut(s) 276
BspLI GGNNCC 3 cut(s) 155, 156, 190
BspT107I GGYRCC 1 cut(s) 188
BsrI ACTGG 1 cut(s) 58
Bst6I CTCTTC 1 cut(s) 86
BstDEI CTNAG 2 cut(s) 101, 263
BstENI CCTNNNNNAGG 1 cut(s) 140
BstF5I GGATG 1 cut(s) 324
BstMAI GTCTC 1 cut(s) 216
BstSCI CCNGG 2 cut(s) 70, 330
BsuI GTATCC 1 cut(s) 139
BsuRI GGCC 2 cut(s) 279, 344
BtsCI GGATG 1 cut(s) 324
Cfr13I GGNCC 2 cut(s) 154, 342
Csp6I GTAC 1 cut(s) 57
CviAII CATG 1 cut(s) 200
CviJI RGCY 5 cut(s) 98, 198, 279, 287, 344
CviKI_1 RGCY 5 cut(s) 98, 198, 279, 287, 344
CviQI GTAC 1 cut(s) 57
DdeI CTNAG 2 cut(s) 101, 263
EaeI YGGCCR 1 cut(s) 277
Eam1104I CTCTTC 1 cut(s) 86
EarI CTCTTC 1 cut(s) 86
Eco24I GRGCYC 1 cut(s) 100
Eco47I GGWCC 1 cut(s) 154
Eco88I CYCGRG 1 cut(s) 150
EcoNI CCTNNNNNAGG 1 cut(s) 140
EcoO109I RGGNCCY 1 cut(s) 154
EcoRI GAATTC 1 cut(s) 115
EcoT38I GRGCYC 1 cut(s) 100
FaeI CATG 1 cut(s) 203
FaiI YATR 7 cut(s) 61, 194, 201, 207, 290, 309, 315
FaqI GGGAC 1 cut(s) 167
FatI CATG 1 cut(s) 199
FokI GGATG 1 cut(s) 311
FriOI GRGCYC 1 cut(s) 100
HaeIII GGCC 2 cut(s) 279, 344
HapII CCGG 2 cut(s) 71, 331
Hin1II CATG 1 cut(s) 203
HincII GTYRAC 1 cut(s) 256
HindII GTYRAC 1 cut(s) 256
HpaI GTTAAC 1 cut(s) 256
HpaII CCGG 2 cut(s) 71, 331
HphI GGTGA 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 256
Hpy188I TCNGA 1 cut(s) 142
Hpy188III TCNNGA 2 cut(s) 152, 215
Hpy8I GTNNAC 1 cut(s) 256
HpyAV CCTTC 1 cut(s) 77
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 1 cut(s) 166
HpyF3I CTNAG 2 cut(s) 101, 263
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 1 cut(s) 203
KflI GGGWCCC 1 cut(s) 154
KspAI GTTAAC 1 cut(s) 256
LpnPI CCDG 3 cut(s) 39, 84, 344
MaeII ACGT 1 cut(s) 63
MboII GAAGA 1 cut(s) 103
MhlI GDGCHC 1 cut(s) 100
MluCI AATT 2 cut(s) 115, 352
MnlI CCTC 5 cut(s) 78, 87, 136, 233, 338
MseI TTAA 1 cut(s) 255
MspI CCGG 2 cut(s) 71, 331
MspR9I CCNGG 2 cut(s) 72, 332
NciI CCSGG 2 cut(s) 72, 332
NlaIII CATG 1 cut(s) 203
NlaIV GGNNCC 3 cut(s) 155, 156, 190
PpuMI RGGWCCY 1 cut(s) 154
Psp5II RGGWCCY 1 cut(s) 154
PspN4I GGNNCC 3 cut(s) 155, 156, 190
PspPI GGNCC 2 cut(s) 154, 342
PspPPI RGGWCCY 1 cut(s) 154
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
SaqAI TTAA 1 cut(s) 255
Sau96I GGNCC 2 cut(s) 154, 342
ScrFI CCNGG 2 cut(s) 72, 332
SduI GDGCHC 1 cut(s) 100
SetI ASST 3 cut(s) 29, 66, 138
SinI GGWCC 1 cut(s) 154
SmlI CTYRAG 2 cut(s) 22, 215
SmoI CTYRAG 2 cut(s) 22, 215
Sse9I AATT 2 cut(s) 115, 352
StyD4I CCNGG 2 cut(s) 70, 330
TaiI ACGT 1 cut(s) 66
TasI AATT 2 cut(s) 115, 352
Tru1I TTAA 1 cut(s) 255
Tru9I TTAA 1 cut(s) 255
VpaK11BI GGWCC 1 cut(s) 154
XagI CCTNNNNNAGG 1 cut(s) 140
XapI RAATTY 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.