Rmu_sc0005550.1_g000002

PB1 domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005550.1
N/A
Physical Location & Seq
Reverse (-)
2673 .. 2975
303 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 303 bp
atgatggggaagcaaagtgggaagaagaaaaaaagttcaggagatagtccaaagccaagcaacagtagcgaaaatagtccgaaaacccaagataaggatacagaagttttcattgcaatggctcatgaattgaaggatgaggggaataagttgtttcagaaaagggaccatggaggagctatgttgaagtatgagaaagccctcagattgcttcccagaaatcacattgatgtgtcctatcttcggagtaatatgagggctttctcatacttcaacatagctcctccatggtcccttttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PB1

Protein Analysis

100

Amino Acids

11.39

Weight (kDa)

9.77

Isoelectric Point (pI)

56.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 94, 243
AgsI TTSAA 3 cut(s) 133, 187, 274
AluBI AGCT 2 cut(s) 179, 281
AluI AGCT 2 cut(s) 179, 281
AspS9I GGNCC 2 cut(s) 166, 291
AvaII GGWCC 2 cut(s) 166, 291
BaeI ACNNNNGTAYC 2 cut(s) 90, 123
BciVI GTATCC 1 cut(s) 91
BfuI GTATCC 1 cut(s) 91
Bme18I GGWCC 2 cut(s) 166, 291
BmgT120I GGNCC 2 cut(s) 166, 291
BmiI GGNNCC 2 cut(s) 167, 293
BsaJI CCNNGG 2 cut(s) 169, 287
Bsc4I CCNNNNNNNGG 2 cut(s) 94, 243
Bse3DI GCAATG 2 cut(s) 111, 123
BseDI CCNNGG 2 cut(s) 169, 287
BseGI GGATG 1 cut(s) 142
BseLI CCNNNNNNNGG 2 cut(s) 94, 243
BseMI GCAATG 2 cut(s) 111, 123
BseMII CTCAG 1 cut(s) 217
BseRI GAGGAG 2 cut(s) 189, 273
BslFI GGGAC 2 cut(s) 179, 277
BslI CCNNNNNNNGG 2 cut(s) 94, 243
BsmFI GGGAC 2 cut(s) 179, 277
Bsp19I CCATGG 2 cut(s) 169, 287
BspCNI CTCAG 1 cut(s) 216
BspHI TCATGA 1 cut(s) 124
BspLI GGNNCC 2 cut(s) 167, 293
BsrDI GCAATG 2 cut(s) 111, 123
BssECI CCNNGG 2 cut(s) 169, 287
BssT1I CCWWGG 2 cut(s) 169, 287
Bst4CI ACNGT 1 cut(s) 65
BstDEI CTNAG 1 cut(s) 203
BstDSI CCRYGG 2 cut(s) 169, 287
BstF5I GGATG 1 cut(s) 142
BstMWI GCNNNNNNNGC 1 cut(s) 66
BsuI GTATCC 1 cut(s) 91
BtgI CCRYGG 2 cut(s) 169, 287
BtsCI GGATG 1 cut(s) 142
CciI TCATGA 1 cut(s) 124
Cfr13I GGNCC 2 cut(s) 166, 291
CviAII CATG 3 cut(s) 125, 170, 288
CviJI RGCY 6 cut(s) 55, 122, 179, 200, 260, 281
CviKI_1 RGCY 6 cut(s) 55, 122, 179, 200, 260, 281
DdeI CTNAG 1 cut(s) 203
Eco130I CCWWGG 2 cut(s) 169, 287
Eco47I GGWCC 2 cut(s) 166, 291
EcoT14I CCWWGG 2 cut(s) 169, 287
ErhI CCWWGG 2 cut(s) 169, 287
FaeI CATG 3 cut(s) 128, 173, 291
FaiI YATR 8 cut(s) 126, 171, 182, 192, 254, 268, 278, 289
FaqI GGGAC 2 cut(s) 179, 277
FatI CATG 3 cut(s) 124, 169, 287
FokI GGATG 1 cut(s) 149
Hin1II CATG 3 cut(s) 128, 173, 291
Hpy188I TCNGA 5 cut(s) 81, 159, 206, 246, 302
Hpy188III TCNNGA 2 cut(s) 39, 125
HpyAV CCTTC 1 cut(s) 127
HpyCH4III ACNGT 1 cut(s) 65
HpyCH4V TGCA 1 cut(s) 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 66
HpyF3I CTNAG 1 cut(s) 203
Hsp92II CATG 3 cut(s) 128, 173, 291
LmnI GCTCC 2 cut(s) 176, 286
LpnPI CCDG 2 cut(s) 24, 229
MboII GAAGA 3 cut(s) 34, 37, 233
MluCI AATT 1 cut(s) 128
MnlI CCTC 5 cut(s) 133, 167, 212, 249, 294
MslI CAYNNNNRTG 3 cut(s) 116, 228, 230
MwoI GCNNNNNNNGC 1 cut(s) 66
NcoI CCATGG 2 cut(s) 169, 287
NlaIII CATG 3 cut(s) 128, 173, 291
NlaIV GGNNCC 2 cut(s) 167, 293
PagI TCATGA 1 cut(s) 124
PspN4I GGNNCC 2 cut(s) 167, 293
PspPI GGNCC 2 cut(s) 166, 291
RseI CAYNNNNRTG 3 cut(s) 116, 228, 230
Sau96I GGNCC 2 cut(s) 166, 291
SetI ASST 2 cut(s) 181, 283
SgeI CNNG 6 cut(s) 51, 69, 101, 137, 182, 228
SinI GGWCC 2 cut(s) 166, 291
SmiMI CAYNNNNRTG 3 cut(s) 116, 228, 230
Sse9I AATT 1 cut(s) 128
StyI CCWWGG 2 cut(s) 169, 287
TaaI ACNGT 1 cut(s) 65
TasI AATT 1 cut(s) 128
TspDTI ATGAA 2 cut(s) 100, 141
VpaK11BI GGWCC 2 cut(s) 166, 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.