Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005582.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

12692 .. 12946

Gene Structure 255 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 255 bp

atggatgcatttagagttgatctattcagcactgtttgctcatcaagccaaggttctggtcatgataattgtgatgccttgggagatgttttcatttggggagaacgcactggagatggtgttggtgctagtggttctcatacagttggaagtagtttttctgccaaaacgaattctttgttgcccaaaccgatagaatctgcagtggttctgctgtccagaacattgcctgtggtggactacgtgcagctctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000726 GO:0003674 GO:0003824 GO:0004842 GO:0005085 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005814 GO:0005815 GO:0005856 GO:0006139 GO:0006259 GO:0006281 GO:0006302 GO:0006303 GO:0006464 GO:0006508 GO:0006511 GO:0006725 GO:0006807 GO:0006810 GO:0006886 GO:0006950 GO:0006974 GO:0008104 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009987 GO:0010498 GO:0015031 GO:0015630 GO:0015833 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0019899 GO:0019941 GO:0030163 GO:0031625 GO:0031974 GO:0031981 GO:0032182 GO:0032183 GO:0032446 GO:0033036 GO:0033554 GO:0034613 GO:0034641 GO:0036211 GO:0042886 GO:0043161 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043412 GO:0043632 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044389 GO:0044422 GO:0044424 GO:0044428 GO:0044430 GO:0044444 GO:0044446 GO:0044450 GO:0044464 GO:0045184 GO:0046483 GO:0046907 GO:0050896 GO:0051020 GO:0051179 GO:0051234 GO:0051603 GO:0051641 GO:0051649 GO:0051716 GO:0061630 GO:0061659 GO:0065007 GO:0065009 GO:0070013 GO:0070647 GO:0070727 GO:0071702 GO:0071704 GO:0071705 GO:0090304 GO:0098772 GO:0140096 GO:1901360 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BRX BRX_N BRX_assoc FYVE PH_12 RCC1

Protein Analysis

84

Amino Acids

8.76

Weight (kDa)

4.69

Isoelectric Point (pI)

24.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	172
AluBI	AGCT	1 cut(s)	250
AluI	AGCT	1 cut(s)	250
ApeKI	GCWGC	1 cut(s)	247
ApoI	RAATTY	1 cut(s)	172
BccI	CCATC	1 cut(s)	110
BfaI	CTAG	2 cut(s)	129, 253
BfmI	CTRYAG	1 cut(s)	201
BisI	GCNGC	1 cut(s)	248
BlsI	GCNGC	1 cut(s)	249
BmsI	GCATC	1 cut(s)	64
BpmI	CTGGAG	1 cut(s)	132
BsaAI	YACGTR	1 cut(s)	244
BsaJI	CCNNGG	2 cut(s)	49, 78
BsaXI	ACNNNNNCTCC	2 cut(s)	105, 135
Bse1I	ACTGG	1 cut(s)	115
Bse3DI	GCAATG	1 cut(s)	224
BseDI	CCNNGG	2 cut(s)	49, 78
BseGI	GGATG	1 cut(s)	10
BseMI	GCAATG	1 cut(s)	224
BseNI	ACTGG	1 cut(s)	115
Bsp143I	GATC	1 cut(s)	19
BspHI	TCATGA	1 cut(s)	61
BspMAI	CTGCAG	1 cut(s)	205
BsrDI	GCAATG	1 cut(s)	224
BsrI	ACTGG	1 cut(s)	115
BssECI	CCNNGG	2 cut(s)	49, 78
BssMI	GATC	1 cut(s)	19
BssT1I	CCWWGG	2 cut(s)	49, 78
Bst4CI	ACNGT	2 cut(s)	34, 145
BstAPI	GCANNNNNTGC	1 cut(s)	36
BstBAI	YACGTR	1 cut(s)	244
BstF5I	GGATG	1 cut(s)	10
BstKTI	GATC	1 cut(s)	22
BstMBI	GATC	1 cut(s)	19
BstMWI	GCNNNNNNNGC	2 cut(s)	36, 45
BstSFI	CTRYAG	1 cut(s)	201
BstXI	CCANNNNNNTGG	1 cut(s)	56
BtsCI	GGATG	1 cut(s)	10
BtsI	GCAGTG	1 cut(s)	210
BtsIMutI	CAGTG	3 cut(s)	30, 108, 210
CciI	TCATGA	1 cut(s)	61
CviAII	CATG	1 cut(s)	62
CviJI	RGCY	2 cut(s)	48, 250
CviKI_1	RGCY	2 cut(s)	48, 250
DpnI	GATC	1 cut(s)	21
DpnII	GATC	1 cut(s)	19
Eco130I	CCWWGG	2 cut(s)	49, 78
EcoRI	GAATTC	1 cut(s)	172
EcoT14I	CCWWGG	2 cut(s)	49, 78
EcoT22I	ATGCAT	1 cut(s)	10
ErhI	CCWWGG	2 cut(s)	49, 78
FaeI	CATG	1 cut(s)	65
FaiI	YATR	2 cut(s)	63, 141
FatI	CATG	1 cut(s)	61
Fnu4HI	GCNGC	1 cut(s)	248
FokI	GGATG	1 cut(s)	17
Fsp4HI	GCNGC	1 cut(s)	248
FspBI	CTAG	2 cut(s)	129, 253
GluI	GCNGC	1 cut(s)	248
GsuI	CTGGAG	1 cut(s)	132
Hin1II	CATG	1 cut(s)	65
HinfI	GANTC	1 cut(s)	197
Hpy166II	GTNNAC	1 cut(s)	238
Hpy188III	TCNNGA	2 cut(s)	62, 219
Hpy8I	GTNNAC	1 cut(s)	238
HpyCH4III	ACNGT	2 cut(s)	34, 145
HpyCH4IV	ACGT	1 cut(s)	243
HpyCH4V	TGCA	3 cut(s)	8, 203, 247
HpyF10VI	GCNNNNNNNGC	2 cut(s)	36, 45
HpySE526I	ACGT	1 cut(s)	243
Hsp92II	CATG	1 cut(s)	65
Kzo9I	GATC	1 cut(s)	19
LpnPI	CCDG	4 cut(s)	42, 96, 232, 243
LweI	GCATC	1 cut(s)	64
MaeI	CTAG	2 cut(s)	129, 253
MaeII	ACGT	1 cut(s)	243
MalI	GATC	1 cut(s)	21
MboI	GATC	1 cut(s)	19
MluCI	AATT	2 cut(s)	67, 172
MmeI	TCCRAC	1 cut(s)	127
Mph1103I	ATGCAT	1 cut(s)	10
MwoI	GCNNNNNNNGC	2 cut(s)	36, 45
NdeII	GATC	1 cut(s)	19
NlaIII	CATG	1 cut(s)	65
NsiI	ATGCAT	1 cut(s)	10
PagI	TCATGA	1 cut(s)	61
PfeI	GAWTC	1 cut(s)	197
PkrI	GCNGC	1 cut(s)	249
Ppu21I	YACGTR	1 cut(s)	244
PstI	CTGCAG	1 cut(s)	205
SatI	GCNGC	1 cut(s)	248
Sau3AI	GATC	1 cut(s)	19
SetI	ASST	3 cut(s)	55, 246, 252
SfaNI	GCATC	1 cut(s)	64
SfcI	CTRYAG	1 cut(s)	201
SgeI	CNNG	9 cut(s)	57, 62, 69, 74, 91, 123, 141, 231, 242
Sse9I	AATT	2 cut(s)	67, 172
SspMI	CTAG	2 cut(s)	129, 253
StyI	CCWWGG	2 cut(s)	49, 78
TaaI	ACNGT	2 cut(s)	34, 145
TaiI	ACGT	1 cut(s)	246
TasI	AATT	2 cut(s)	67, 172
TfiI	GAWTC	1 cut(s)	197
TscAI	CASTG	3 cut(s)	37, 115, 210
TseI	GCWGC	1 cut(s)	247
TspDTI	ATGAA	1 cut(s)	82
TspRI	CASTG	3 cut(s)	37, 115, 210
XapI	RAATTY	1 cut(s)	172
XspI	CTAG	2 cut(s)	129, 253
Zsp2I	ATGCAT	1 cut(s)	10

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.