Rmu_sc0005657.1_g000004

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005657.1
N/A
Physical Location & Seq
Forward (+)
30270 .. 30752
483 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 483 bp
atgtcgaatgaacctaaactcgactttcccatacttgattcaacaggttttgaacaccattgttgggtaaccgatgttgagaaccacctcacttcaaaagggatattacccataatccaggaaccaacccctagagttaattttgagcgaacaacagttaggcatgctcaagctgctctcatcttgatgcgacgacacacggatagatcactccgtctggagtatatgtcgatcaaagatgcaagagaattatgggtagcgctagaagaacgctttaacaatgtccaagattccctcctccctgacttgaagcttcaatggaccaatttgcgcttcgccgacttcaagtccgtctctaaatacaattcaaaagctctacgcctcaaggctatgttgaatttctgtggacaacctgtcacagagcaagagctaattgagaaaactctctccacattccccatcttagcaattttggtatcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

160

Amino Acids

18.58

Weight (kDa)

6.97

Isoelectric Point (pI)

49.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_2 PF14223 33 - 153 4.6e-06 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 397
AfeI AGCGCT 1 cut(s) 261
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 8 cut(s) 42, 53, 96, 310, 317, 346, 369, 397
AhdI GACNNNNNGTC 2 cut(s) 346, 413
AjnI CCWGG 1 cut(s) 117
AjuI GAANNNNNNNTTGG 2 cut(s) 317, 349
AluBI AGCT 4 cut(s) 173, 313, 374, 430
AluI AGCT 4 cut(s) 173, 313, 374, 430
Alw26I GTCTC 1 cut(s) 358
Aor51HI AGCGCT 1 cut(s) 261
ApeKI GCWGC 1 cut(s) 173
ApoI RAATTY 1 cut(s) 397
AspLEI GCGC 2 cut(s) 262, 333
AspS9I GGNCC 1 cut(s) 321
AvaII GGWCC 1 cut(s) 321
BbvI GCAGC 1 cut(s) 160
BccI CCATC 1 cut(s) 467
BciT130I CCWGG 1 cut(s) 119
BcoDI GTCTC 1 cut(s) 358
BfaI CTAG 2 cut(s) 132, 263
BfoI RGCGCY 1 cut(s) 263
BisI GCNGC 1 cut(s) 174
BlsI GCNGC 1 cut(s) 175
Bme1390I CCNGG 1 cut(s) 119
Bme18I GGWCC 1 cut(s) 321
BmeRI GACNNNNNGTC 2 cut(s) 346, 413
BmgT120I GGNCC 1 cut(s) 321
BmiI GGNNCC 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 119
BmsI GCATC 2 cut(s) 177, 229
BpmI CTGGAG 1 cut(s) 239
BpuEI CTTGAG 2 cut(s) 153, 368
BsaXI ACNNNNNCTCC 2 cut(s) 212, 242
Bsc4I CCNNNNNNNGG 1 cut(s) 64
BseBI CCWGG 1 cut(s) 119
BseLI CCNNNNNNNGG 1 cut(s) 64
BseRI GAGGAG 1 cut(s) 287
BseXI GCAGC 1 cut(s) 160
BslI CCNNNNNNNGG 1 cut(s) 64
BsmAI GTCTC 1 cut(s) 358
BsmBI CGTCTC 1 cut(s) 358
Bsp143I GATC 2 cut(s) 206, 231
BspLI GGNNCC 1 cut(s) 123
BssMI GATC 2 cut(s) 206, 231
Bst2UI CCWGG 1 cut(s) 119
Bst4CI ACNGT 1 cut(s) 157
BstC8I GCNNGC 1 cut(s) 165
BstDEI CTNAG 2 cut(s) 463, 480
BstEII GGTNACC 1 cut(s) 67
BstH2I RGCGCY 1 cut(s) 263
BstHHI GCGC 2 cut(s) 262, 333
BstKTI GATC 2 cut(s) 209, 234
BstMAI GTCTC 1 cut(s) 358
BstMBI GATC 2 cut(s) 206, 231
BstMWI GCNNNNNNNGC 1 cut(s) 173
BstNI CCWGG 1 cut(s) 119
BstNSI RCATGY 1 cut(s) 167
BstPI GGTNACC 1 cut(s) 67
BstSCI CCNGG 1 cut(s) 117
BstV1I GCAGC 1 cut(s) 160
Cac8I GCNNGC 1 cut(s) 165
CfoI GCGC 2 cut(s) 262, 333
Cfr13I GGNCC 1 cut(s) 321
CviAII CATG 1 cut(s) 164
CviJI RGCY 5 cut(s) 173, 313, 374, 389, 430
CviKI_1 RGCY 5 cut(s) 173, 313, 374, 389, 430
DdeI CTNAG 2 cut(s) 463, 480
DpnI GATC 2 cut(s) 208, 233
DpnII GATC 2 cut(s) 206, 231
DriI GACNNNNNGTC 2 cut(s) 346, 413
Eam1105I GACNNNNNGTC 2 cut(s) 346, 413
Eco47I GGWCC 1 cut(s) 321
Eco47III AGCGCT 1 cut(s) 261
Eco91I GGTNACC 1 cut(s) 67
EcoO65I GGTNACC 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 117
Esp3I CGTCTC 1 cut(s) 358
FaeI CATG 1 cut(s) 167
FaiI YATR 7 cut(s) 32, 113, 165, 225, 227, 253, 392
FatI CATG 1 cut(s) 163
Fnu4HI GCNGC 1 cut(s) 174
Fsp4HI GCNGC 1 cut(s) 174
FspBI CTAG 2 cut(s) 132, 263
GlaI GCGC 2 cut(s) 261, 332
GluI GCNGC 1 cut(s) 174
GsuI CTGGAG 1 cut(s) 239
HaeII RGCGCY 1 cut(s) 263
HhaI GCGC 2 cut(s) 262, 333
Hin1II CATG 1 cut(s) 167
Hin6I GCGC 2 cut(s) 260, 331
HinP1I GCGC 2 cut(s) 260, 331
HindIII AAGCTT 1 cut(s) 311
HinfI GANTC 2 cut(s) 38, 290
Hpy166II GTNNAC 1 cut(s) 407
Hpy188III TCNNGA 2 cut(s) 184, 218
Hpy8I GTNNAC 1 cut(s) 407
Hpy99I CGWCG 1 cut(s) 195
HpyCH4III ACNGT 1 cut(s) 157
HpyCH4V TGCA 1 cut(s) 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 173
HpyF3I CTNAG 2 cut(s) 463, 480
Hsp92II CATG 1 cut(s) 167
HspAI GCGC 2 cut(s) 260, 331
Kzo9I GATC 2 cut(s) 206, 231
LpnPI CCDG 6 cut(s) 30, 104, 131, 203, 315, 426
Lsp1109I GCAGC 1 cut(s) 160
LweI GCATC 2 cut(s) 177, 229
MaeI CTAG 2 cut(s) 132, 263
MaeIII GTNAC 2 cut(s) 67, 415
MalI GATC 2 cut(s) 208, 233
MboI GATC 2 cut(s) 206, 231
MboII GAAGA 1 cut(s) 278
MluCI AATT 7 cut(s) 139, 248, 325, 364, 397, 432, 468
MnlI CCTC 4 cut(s) 98, 305, 308, 392
MseI TTAA 2 cut(s) 138, 276
MslI CAYNNNNRTG 1 cut(s) 185
MspR9I CCNGG 1 cut(s) 119
MvaI CCWGG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 173
NdeII GATC 2 cut(s) 206, 231
NlaIII CATG 1 cut(s) 167
NlaIV GGNNCC 1 cut(s) 123
NmuCI GTSAC 1 cut(s) 415
NspI RCATGY 1 cut(s) 167
PaeI GCATGC 1 cut(s) 167
PfeI GAWTC 2 cut(s) 38, 290
PfoI TCCNGGA 1 cut(s) 117
PkrI GCNGC 1 cut(s) 175
Psp6I CCWGG 1 cut(s) 117
PspEI GGTNACC 1 cut(s) 67
PspGI CCWGG 1 cut(s) 117
PspN4I GGNNCC 1 cut(s) 123
PspPI GGNCC 1 cut(s) 321
RseI CAYNNNNRTG 1 cut(s) 185
SaqAI TTAA 2 cut(s) 138, 276
SatI GCNGC 1 cut(s) 174
Sau3AI GATC 2 cut(s) 206, 231
Sau96I GGNCC 1 cut(s) 321
ScrFI CCNGG 1 cut(s) 119
SetI ASST 8 cut(s) 16, 49, 90, 175, 315, 376, 415, 432
SfaNI GCATC 2 cut(s) 177, 229
SinI GGWCC 1 cut(s) 321
SmiMI CAYNNNNRTG 1 cut(s) 185
SmlI CTYRAG 2 cut(s) 168, 383
SmoI CTYRAG 2 cut(s) 168, 383
SphI GCATGC 1 cut(s) 167
Sse9I AATT 7 cut(s) 139, 248, 325, 364, 397, 432, 468
SspMI CTAG 2 cut(s) 132, 263
StyD4I CCNGG 1 cut(s) 117
TaaI ACNGT 1 cut(s) 157
TaqI TCGA 3 cut(s) 5, 21, 230
TasI AATT 7 cut(s) 139, 248, 325, 364, 397, 432, 468
TfiI GAWTC 2 cut(s) 38, 290
Tru1I TTAA 2 cut(s) 138, 276
Tru9I TTAA 2 cut(s) 138, 276
TseFI GTSAC 1 cut(s) 415
TseI GCWGC 1 cut(s) 173
Tsp45I GTSAC 1 cut(s) 415
TspDTI ATGAA 1 cut(s) 24
TspGWI ACGGA 3 cut(s) 203, 215, 340
VpaK11BI GGWCC 1 cut(s) 321
XapI RAATTY 1 cut(s) 397
XceI RCATGY 1 cut(s) 167
XspI CTAG 2 cut(s) 132, 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.