Rmu_sc0005657.1_g000070

calcium-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005657.1
N/A
Physical Location & Seq
Forward (+)
373890 .. 374415
526 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 318 bp
atggtggcaaaccgtagtatgagagacaaagactccaatcctaatgtccatgagagcctttcaagaagctttgtatcagtggaggagccaaagccagagacaagggcagggcctggcttgatttcctgtactactttcaatattctggctccaatctacaaacgactcgatcaactgaatcaagggcttcgtgagagtgaattcagctcattctgggtgactaggaatcaaaagattttggattggttactgtatgattcgtctactattatatgtctccaggtgatctttatgtacccttttgctcttttgtgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006950 GO:0008150 GO:0009266 GO:0009409 GO:0009628 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0050896
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EF-hand_8 Exo_endo_phos

Protein Analysis

105

Amino Acids

12.09

Weight (kDa)

6.55

Isoelectric Point (pI)

69.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 263
AcsI RAATTY 1 cut(s) 200
AfaI GTAC 2 cut(s) 130, 296
AgsI TTSAA 2 cut(s) 63, 139
AjnI CCWGG 2 cut(s) 112, 279
AluBI AGCT 2 cut(s) 69, 207
AluI AGCT 2 cut(s) 69, 207
Alw26I GTCTC 3 cut(s) 18, 92, 281
AlwNI CAGNNNCTG 1 cut(s) 113
AoxI GGCC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 200
AspS9I GGNCC 1 cut(s) 110
AsuHPI GGTGA 2 cut(s) 229, 295
BciT130I CCWGG 2 cut(s) 114, 281
BcoDI GTCTC 3 cut(s) 18, 92, 281
BfaI CTAG 1 cut(s) 222
Bme1390I CCNGG 2 cut(s) 114, 281
BmgT120I GGNCC 1 cut(s) 110
BmiI GGNNCC 2 cut(s) 87, 150
BmrFI CCNGG 2 cut(s) 114, 281
BpmI CTGGAG 1 cut(s) 263
BsaXI ACNNNNNCTCC 2 cut(s) 17, 47
BseBI CCWGG 2 cut(s) 114, 281
BseRI GAGGAG 1 cut(s) 98
BshFI GGCC 1 cut(s) 112
BsmAI GTCTC 3 cut(s) 18, 92, 281
BsnI GGCC 1 cut(s) 112
Bsp143I GATC 2 cut(s) 169, 285
BspANI GGCC 1 cut(s) 112
BspLI GGNNCC 2 cut(s) 87, 150
BssMI GATC 2 cut(s) 169, 285
Bst2UI CCWGG 2 cut(s) 114, 281
Bst4CI ACNGT 2 cut(s) 14, 252
BstKTI GATC 2 cut(s) 172, 288
BstMAI GTCTC 3 cut(s) 18, 92, 281
BstMBI GATC 2 cut(s) 169, 285
BstNI CCWGG 2 cut(s) 114, 281
BstSCI CCNGG 2 cut(s) 112, 279
BsuRI GGCC 1 cut(s) 112
BtsIMutI CAGTG 1 cut(s) 84
CaiI CAGNNNCTG 1 cut(s) 113
Cfr13I GGNCC 1 cut(s) 110
Csp6I GTAC 2 cut(s) 129, 295
CviAII CATG 1 cut(s) 50
CviJI RGCY 9 cut(s) 57, 69, 88, 94, 112, 117, 149, 187, 207
CviKI_1 RGCY 9 cut(s) 57, 69, 88, 94, 112, 117, 149, 187, 207
CviQI GTAC 2 cut(s) 129, 295
DpnI GATC 2 cut(s) 171, 287
DpnII GATC 2 cut(s) 169, 285
EcoO109I RGGNCCY 1 cut(s) 110
EcoRI GAATTC 1 cut(s) 200
EcoRII CCWGG 2 cut(s) 112, 279
FaeI CATG 1 cut(s) 53
FaiI YATR 6 cut(s) 20, 51, 255, 272, 274, 293
FatI CATG 1 cut(s) 49
FblI GTMKAC 1 cut(s) 263
FspBI CTAG 1 cut(s) 222
GsuI CTGGAG 1 cut(s) 263
HaeIII GGCC 1 cut(s) 112
Hin1II CATG 1 cut(s) 53
HindIII AAGCTT 1 cut(s) 67
HinfI GANTC 5 cut(s) 32, 165, 178, 226, 257
HphI GGTGA 2 cut(s) 229, 295
Hpy166II GTNNAC 1 cut(s) 264
Hpy188III TCNNGA 2 cut(s) 63, 191
Hpy8I GTNNAC 1 cut(s) 264
HpyCH4III ACNGT 2 cut(s) 14, 252
Hsp92II CATG 1 cut(s) 53
Kzo9I GATC 2 cut(s) 169, 285
LmnI GCTCC 2 cut(s) 85, 154
LpnPI CCDG 9 cut(s) 93, 99, 108, 126, 131, 139, 199, 266, 293
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 2 cut(s) 217, 246
MalI GATC 2 cut(s) 171, 287
MboI GATC 2 cut(s) 169, 285
MluCI AATT 1 cut(s) 200
MlyI GAGTC 2 cut(s) 26, 159
MnlI CCTC 1 cut(s) 76
MspR9I CCNGG 2 cut(s) 114, 281
MvaI CCWGG 2 cut(s) 114, 281
NdeII GATC 2 cut(s) 169, 285
NlaIII CATG 1 cut(s) 53
NlaIV GGNNCC 2 cut(s) 87, 150
NmuCI GTSAC 1 cut(s) 217
PfeI GAWTC 3 cut(s) 178, 226, 257
PleI GAGTC 2 cut(s) 26, 159
PpsI GAGTC 2 cut(s) 26, 159
Psp6I CCWGG 2 cut(s) 112, 279
PspGI CCWGG 2 cut(s) 112, 279
PspN4I GGNNCC 2 cut(s) 87, 150
PspPI GGNCC 1 cut(s) 110
PstNI CAGNNNCTG 1 cut(s) 113
RsaI GTAC 2 cut(s) 130, 296
RsaNI GTAC 2 cut(s) 129, 295
Sau3AI GATC 2 cut(s) 169, 285
Sau96I GGNCC 1 cut(s) 110
SchI GAGTC 2 cut(s) 26, 159
ScrFI CCNGG 2 cut(s) 114, 281
SetI ASST 3 cut(s) 71, 209, 285
Sse9I AATT 1 cut(s) 200
SspI AATATT 1 cut(s) 142
SspMI CTAG 1 cut(s) 222
StyD4I CCNGG 2 cut(s) 112, 279
TaaI ACNGT 2 cut(s) 14, 252
TaqI TCGA 1 cut(s) 168
TasI AATT 1 cut(s) 200
TatI WGTACW 1 cut(s) 128
TfiI GAWTC 3 cut(s) 178, 226, 257
TscAI CASTG 1 cut(s) 84
TseFI GTSAC 1 cut(s) 217
Tsp45I GTSAC 1 cut(s) 217
TspRI CASTG 1 cut(s) 84
XapI RAATTY 1 cut(s) 200
XmiI GTMKAC 1 cut(s) 263
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.