Rmu_sc0005743.1_g000014

Tropinone reductase homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005743.1
OG0031352
Physical Location & Seq
Forward (+)
59631 .. 61706
2076 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 486 bp
atgaatgtacaggaaagtgtaggagttgccaaggctcaggatatgctagttattctaataaaagagggaagaaaaatgtttgcaaatgcataccttgccaaggaatcggtaaataatgctgcaatagtcacacttagaggaactacagattatagtttagaagatttttcgagtatgatgagcagcaatgttgaatctccctaccatctttgtcaactagtacatcctcttctgaaggcatcaggacatggaagcattatatttgtctcctctattgctggtgtaatagctctgcctaaactatctggctatgcagcaaccaaaggagctatcacccagatttcaaagaatttggcatgtgaatgggcgaaagacaacattcggacaaatactgtagcaccatgggctgtcaacattggggcagcagcagttgaaccgtgcatgcagctgtggaaagcttggctctcaagcttaaggaggagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00960 ko01100 ko01110 map00960 map01100 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

161

Amino Acids

17.44

Weight (kDa)

9.24

Isoelectric Point (pI)

44.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
adh_short PF00106 37 - 138 1.1e-24 short chain dehydrogenase
adh_short_C2 PF13561 37 - 143 8.1e-23 Enoyl-(Acyl carrier protein) reductase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031352)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0005743.1_g000014 Rmu_sc0009101.1_g000011

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 349
AcuI CTGAAG 1 cut(s) 254
AfaI GTAC 2 cut(s) 9, 222
AfiI CCNNNNNNNGG 1 cut(s) 100
AflII CTTAAG 1 cut(s) 472
AgsI TTSAA 3 cut(s) 194, 345, 434
AhlI ACTAGT 1 cut(s) 217
AluBI AGCT 5 cut(s) 290, 329, 448, 458, 471
AluI AGCT 5 cut(s) 290, 329, 448, 458, 471
Alw26I GTCTC 1 cut(s) 271
ApeKI GCWGC 6 cut(s) 119, 183, 314, 422, 425, 445
ApoI RAATTY 1 cut(s) 349
AsuHPI GGTGA 1 cut(s) 325
BarI GAAGNNNNNNTAC 2 cut(s) 213, 245
BbvI GCAGC 6 cut(s) 106, 195, 326, 434, 437, 457
BccI CCATC 1 cut(s) 213
BcoDI GTCTC 1 cut(s) 271
BcuI ACTAGT 1 cut(s) 217
BfaI CTAG 2 cut(s) 47, 218
BfmI CTRYAG 2 cut(s) 144, 393
BfrI CTTAAG 1 cut(s) 472
BisI GCNGC 6 cut(s) 120, 184, 315, 423, 426, 446
BlsI GCNGC 6 cut(s) 121, 185, 316, 424, 427, 447
BmsI GCATC 1 cut(s) 248
Bpu10I CCTNAGC 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 451
BsaJI CCNNGG 3 cut(s) 30, 99, 401
Bsc4I CCNNNNNNNGG 1 cut(s) 100
Bse3DI GCAATG 1 cut(s) 193
BseDI CCNNGG 3 cut(s) 30, 99, 401
BseGI GGATG 1 cut(s) 223
BseLI CCNNNNNNNGG 1 cut(s) 100
BseMI GCAATG 1 cut(s) 193
BseMII CTCAG 1 cut(s) 50
BseRI GAGGAG 1 cut(s) 259
BseXI GCAGC 6 cut(s) 106, 195, 326, 434, 437, 457
BslI CCNNNNNNNGG 1 cut(s) 100
BsmAI GTCTC 1 cut(s) 271
Bsp1407I TGTACA 1 cut(s) 7
Bsp19I CCATGG 1 cut(s) 401
BspCNI CTCAG 1 cut(s) 49
BspTI CTTAAG 1 cut(s) 472
BsrDI GCAATG 1 cut(s) 193
BsrGI TGTACA 1 cut(s) 7
BssECI CCNNGG 3 cut(s) 30, 99, 401
BssT1I CCWWGG 3 cut(s) 30, 99, 401
Bst4CI ACNGT 2 cut(s) 394, 438
Bst6I CTCTTC 1 cut(s) 234
BstAFI CTTAAG 1 cut(s) 472
BstAPI GCANNNNNTGC 1 cut(s) 95
BstAUI TGTACA 1 cut(s) 7
BstC8I GCNNGC 1 cut(s) 443
BstDEI CTNAG 2 cut(s) 36, 134
BstDSI CCRYGG 1 cut(s) 401
BstENI CCTNNNNNAGG 1 cut(s) 98
BstF5I GGATG 1 cut(s) 223
BstMAI GTCTC 1 cut(s) 271
BstMWI GCNNNNNNNGC 2 cut(s) 95, 404
BstNSI RCATGY 2 cut(s) 360, 445
BstSFI CTRYAG 2 cut(s) 144, 393
BstV1I GCAGC 6 cut(s) 106, 195, 326, 434, 437, 457
BtgI CCRYGG 1 cut(s) 401
BtsCI GGATG 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 443
Csp6I GTAC 2 cut(s) 8, 221
CviAII CATG 4 cut(s) 248, 357, 402, 442
CviJI RGCY 9 cut(s) 35, 290, 309, 329, 407, 448, 458, 463, 471
CviKI_1 RGCY 9 cut(s) 35, 290, 309, 329, 407, 448, 458, 463, 471
CviQI GTAC 2 cut(s) 8, 221
DdeI CTNAG 2 cut(s) 36, 134
Eam1104I CTCTTC 1 cut(s) 234
EarI CTCTTC 1 cut(s) 234
Eco130I CCWWGG 3 cut(s) 30, 99, 401
Eco57I CTGAAG 1 cut(s) 254
EcoNI CCTNNNNNAGG 1 cut(s) 98
EcoT14I CCWWGG 3 cut(s) 30, 99, 401
EcoT22I ATGCAT 1 cut(s) 91
ErhI CCWWGG 3 cut(s) 30, 99, 401
FaeI CATG 4 cut(s) 251, 360, 405, 445
FatI CATG 4 cut(s) 247, 356, 401, 441
Fnu4HI GCNGC 6 cut(s) 120, 184, 315, 423, 426, 446
FokI GGATG 1 cut(s) 210
Fsp4HI GCNGC 6 cut(s) 120, 184, 315, 423, 426, 446
FspBI CTAG 2 cut(s) 47, 218
GluI GCNGC 6 cut(s) 120, 184, 315, 423, 426, 446
Hin1II CATG 4 cut(s) 251, 360, 405, 445
HincII GTYRAC 2 cut(s) 215, 412
HindII GTYRAC 2 cut(s) 215, 412
HindIII AAGCTT 2 cut(s) 456, 469
HinfI GANTC 2 cut(s) 104, 194
HphI GGTGA 1 cut(s) 325
Hpy166II GTNNAC 2 cut(s) 215, 412
Hpy188I TCNGA 2 cut(s) 234, 384
Hpy188III TCNNGA 2 cut(s) 38, 243
Hpy8I GTNNAC 2 cut(s) 215, 412
HpyAV CCTTC 1 cut(s) 229
HpyCH4III ACNGT 2 cut(s) 394, 438
HpyCH4V TGCA 6 cut(s) 83, 89, 122, 314, 441, 445
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 404
HpyF3I CTNAG 2 cut(s) 36, 134
Hsp92II CATG 4 cut(s) 251, 360, 405, 445
LmnI GCTCC 1 cut(s) 326
LpnPI CCDG 5 cut(s) 23, 228, 264, 291, 350
Lsp1109I GCAGC 6 cut(s) 106, 195, 326, 434, 437, 457
LweI GCATC 1 cut(s) 248
MaeI CTAG 2 cut(s) 47, 218
MaeIII GTNAC 1 cut(s) 127
MboII GAAGA 3 cut(s) 81, 173, 221
MluCI AATT 1 cut(s) 349
MnlI CCTC 5 cut(s) 58, 131, 237, 280, 471
Mph1103I ATGCAT 1 cut(s) 91
MseI TTAA 1 cut(s) 473
MslI CAYNNNNRTG 1 cut(s) 361
MspA1I CMGCKG 1 cut(s) 448
MspCI CTTAAG 1 cut(s) 472
MwoI GCNNNNNNNGC 2 cut(s) 95, 404
NcoI CCATGG 1 cut(s) 401
NlaIII CATG 4 cut(s) 251, 360, 405, 445
NmuCI GTSAC 1 cut(s) 127
NsiI ATGCAT 1 cut(s) 91
NspI RCATGY 2 cut(s) 360, 445
PaeI GCATGC 1 cut(s) 445
PfeI GAWTC 2 cut(s) 104, 194
PkrI GCNGC 6 cut(s) 121, 185, 316, 424, 427, 447
PvuII CAGCTG 1 cut(s) 448
RsaI GTAC 2 cut(s) 9, 222
RsaNI GTAC 2 cut(s) 8, 221
RseI CAYNNNNRTG 1 cut(s) 361
SaqAI TTAA 1 cut(s) 473
SatI GCNGC 6 cut(s) 120, 184, 315, 423, 426, 446
SetI ASST 6 cut(s) 96, 292, 331, 450, 460, 473
SfaNI GCATC 1 cut(s) 248
SfcI CTRYAG 2 cut(s) 144, 393
SmiMI CAYNNNNRTG 1 cut(s) 361
SmlI CTYRAG 2 cut(s) 466, 472
SmoI CTYRAG 2 cut(s) 466, 472
SpeI ACTAGT 1 cut(s) 217
SphI GCATGC 1 cut(s) 445
Sse9I AATT 1 cut(s) 349
SspMI CTAG 2 cut(s) 47, 218
StyI CCWWGG 3 cut(s) 30, 99, 401
TaaI ACNGT 2 cut(s) 394, 438
TaqI TCGA 1 cut(s) 170
TasI AATT 1 cut(s) 349
TatI WGTACW 2 cut(s) 7, 220
TfiI GAWTC 2 cut(s) 104, 194
Tru1I TTAA 1 cut(s) 473
Tru9I TTAA 1 cut(s) 473
TseFI GTSAC 1 cut(s) 127
TseI GCWGC 6 cut(s) 119, 183, 314, 422, 425, 445
Tsp45I GTSAC 1 cut(s) 127
TspDTI ATGAA 1 cut(s) 17
Vha464I CTTAAG 1 cut(s) 472
XagI CCTNNNNNAGG 1 cut(s) 98
XapI RAATTY 1 cut(s) 349
XceI RCATGY 2 cut(s) 360, 445
XspI CTAG 2 cut(s) 47, 218
Zsp2I ATGCAT 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.