Rmu_sc0005748.1_g000008

Transmembrane protein 18

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005748.1
N/A
Physical Location & Seq
Forward (+)
31170 .. 31968
799 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 267 bp
atggagcagattcggtctgctatggaagctcacctggaccaagtagcagatctcgtccagaaactgtccgcagacttccgctctggtcttggacccgctttagataactattttgatgaagtttatctcctcatggttaaactccccttagaaaagtataagcatataaatggtatggatataaatgtttctaatggatgtggaacattggcttctggccacacttgtgatgaagcacataatatttatacgcttgtggctagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TMEM18

Protein Analysis

88

Amino Acids

9.77

Weight (kDa)

5.11

Isoelectric Point (pI)

27.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 81
AciI CCGC 3 cut(s) 69, 79, 96
AcoI YGGCCR 1 cut(s) 217
AjnI CCWGG 1 cut(s) 33
AleI CACNNNNGTG 1 cut(s) 225
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
AlwNI CAGNNNCTG 1 cut(s) 64
AoxI GGCC 1 cut(s) 217
AspS9I GGNCC 2 cut(s) 37, 92
AsuHPI GGTGA 1 cut(s) 23
AvaII GGWCC 2 cut(s) 37, 92
BalI TGGCCA 1 cut(s) 219
BciT130I CCWGG 1 cut(s) 35
BfaI CTAG 1 cut(s) 261
BglII AGATCT 1 cut(s) 49
Bme1390I CCNGG 1 cut(s) 35
Bme18I GGWCC 2 cut(s) 37, 92
BmgT120I GGNCC 2 cut(s) 37, 92
BmiI GGNNCC 1 cut(s) 94
BmrFI CCNGG 1 cut(s) 35
BseBI CCWGG 1 cut(s) 35
BseGI GGATG 1 cut(s) 203
BseRI GAGGAG 1 cut(s) 119
BshFI GGCC 1 cut(s) 219
BsnI GGCC 1 cut(s) 219
Bsp143I GATC 1 cut(s) 49
BspACI CCGC 3 cut(s) 69, 79, 96
BspANI GGCC 1 cut(s) 219
BspLI GGNNCC 1 cut(s) 94
BsrBI CCGCTC 1 cut(s) 81
BssMI GATC 1 cut(s) 49
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 148
BstF5I GGATG 1 cut(s) 203
BstKTI GATC 1 cut(s) 52
BstMBI GATC 1 cut(s) 49
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BsuRI GGCC 1 cut(s) 219
BtsCI GGATG 1 cut(s) 203
CaiI CAGNNNCTG 1 cut(s) 64
Cfr13I GGNCC 2 cut(s) 37, 92
CviAII CATG 1 cut(s) 133
CviJI RGCY 4 cut(s) 29, 212, 219, 260
CviKI_1 RGCY 4 cut(s) 29, 212, 219, 260
DdeI CTNAG 1 cut(s) 148
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
EaeI YGGCCR 1 cut(s) 217
Eco47I GGWCC 2 cut(s) 37, 92
EcoRII CCWGG 1 cut(s) 33
FaeI CATG 1 cut(s) 136
FaiI YATR 9 cut(s) 23, 134, 159, 165, 167, 176, 182, 240, 249
FatI CATG 1 cut(s) 132
FauI CCCGC 1 cut(s) 103
FokI GGATG 1 cut(s) 210
FspBI CTAG 1 cut(s) 261
HaeIII GGCC 1 cut(s) 219
Hin1II CATG 1 cut(s) 136
HinfI GANTC 1 cut(s) 10
HphI GGTGA 1 cut(s) 23
Hpy188III TCNNGA 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 66
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 1 cut(s) 148
Hsp92II CATG 1 cut(s) 136
Kzo9I GATC 1 cut(s) 49
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 5 cut(s) 20, 47, 69, 71, 201
MaeI CTAG 1 cut(s) 261
MalI GATC 1 cut(s) 51
MbiI CCGCTC 1 cut(s) 81
MboI GATC 1 cut(s) 49
MflI RGATCY 1 cut(s) 49
MlsI TGGCCA 1 cut(s) 219
MluNI TGGCCA 1 cut(s) 219
MnlI CCTC 1 cut(s) 140
Mox20I TGGCCA 1 cut(s) 219
MscI TGGCCA 1 cut(s) 219
MseI TTAA 1 cut(s) 138
MslI CAYNNNNRTG 2 cut(s) 168, 225
Msp20I TGGCCA 1 cut(s) 219
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
MwoI GCNNNNNNNGC 1 cut(s) 26
NdeII GATC 1 cut(s) 49
NlaIII CATG 1 cut(s) 136
NlaIV GGNNCC 1 cut(s) 94
OliI CACNNNNGTG 1 cut(s) 225
PfeI GAWTC 1 cut(s) 10
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 94
PspPI GGNCC 2 cut(s) 37, 92
PstNI CAGNNNCTG 1 cut(s) 64
PsuI RGATCY 1 cut(s) 49
RseI CAYNNNNRTG 2 cut(s) 168, 225
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 1 cut(s) 49
Sau96I GGNCC 2 cut(s) 37, 92
ScrFI CCNGG 1 cut(s) 35
SetI ASST 2 cut(s) 31, 36
SinI GGWCC 2 cut(s) 37, 92
SmiMI CAYNNNNRTG 2 cut(s) 168, 225
SsiI CCGC 3 cut(s) 69, 79, 96
SspI AATATT 1 cut(s) 244
SspMI CTAG 1 cut(s) 261
StyD4I CCNGG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 66
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TspDTI ATGAA 2 cut(s) 132, 246
VpaK11BI GGWCC 2 cut(s) 37, 92
XspI CTAG 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.